Stem-loop sequence hco-mir-63a

AccessionMI0019994 (change log)
DescriptionHaemonchus contortus miR-63a stem-loop
Literature search

1 open access papers mention hco-mir-63a
(1 sentences)

Stem-loop
   -----cuuguauucu   ga       a  u     --    ga     c  -  u 
5'                ucu  ugaucau cc guucg  acgg  gucau gu cc u
                  |||  ||||||| || |||||  ||||  ||||| || ||  
3'                gga  acuggua gg caagc  uguc  cagua ca gg a
   auacgccuugcuuac   -a       g  u     gu    -a     a  u  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-63a

Accession MIMAT0023318
Sequence

57 - 

aaugacacuguugcgaacugggau

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).