Stem-loop sequence ame-mir-6051

AccessionMI0020322 (change log)
DescriptionApis mellifera miR-6051 stem-loop
Stem-loop
   --cuuuau     a       u             cuu 
5'         uugua ucagagc uguguaauuuucu   g
           ||||| ||||||| |||||||||||||    
3'         aauau agucucg acgcguuaaaaga   a
   aaauaucu     a       c             acu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000062.5: 1872073-1872148 [+]
intergenic
Database links

Mature sequence ame-miR-6051-3p

Accession MIMAT0023675
Sequence

44 - 

aaaauugcgcacgcucugaauau

 - 66

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22458842 "Next-generation small RNA sequencing for microRNAs profiling in Apis mellifera: comparison between nurses and foragers" Liu F, Peng W, Li Z, Li W, Li L, Pan J, Zhang S, Miao Y, Chen S, Su S Insect Mol Biol. 21:297-303(2012).