Stem-loop sequence ame-mir-6058

AccessionMI0020329 (change log)
DescriptionApis mellifera miR-6058 stem-loop
Stem-loop
   -     c   -ga  a  a     a    ---     gga 
5'  aguug ugu   ug ca uggug ugac   aacgu   u
    ||||| |||   || || ||||| ||||   |||||    
3'  ucagc aua   ac gu accac acug   uugca   a
   a     a   aca  c  a     a    caa     aag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000063.5: 4329895-4329971 [-]
intergenic
Database links

Mature sequence ame-miR-6058-5p

Accession MIMAT0023682
Sequence

11 - 

augacaauggugaugacaacg

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22458842 "Next-generation small RNA sequencing for microRNAs profiling in Apis mellifera: comparison between nurses and foragers" Liu F, Peng W, Li Z, Li W, Li L, Pan J, Zhang S, Miao Y, Chen S, Su S Insect Mol Biol. 21:297-303(2012).