Stem-loop sequence cgr-mir-92b

AccessionMI0020561 (change log)
DescriptionCricetulus griseus miR-92b stem-loop
Gene family MIPF0000013; mir-25
Literature search

1 open access papers mention cgr-mir-92b
(1 sentences)

Stem-loop
   --  c    g     ga       c            uucuu 
5'   gg gggc ggagg  cgggacg ggugcaguguug     u
     || |||| |||||  ||||||| ||||||||||||     c
3'   cc cccg ccucc  gcccugc ucacguuauaac     c
   cu  -    g     -g       -            cgccc 
Get sequence
Deep sequencing
57805 reads, 400 reads per million, 6 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH000275.1: 397429-397510 [-]
intergenic
Database links

Mature sequence cgr-miR-92b-5p

Accession MIMAT0024011
Sequence

11 - 

agggacgggacgcggugcaguguu

 - 34

Get sequence
Deep sequencing327 reads, 6 experiments
Evidence experimental; Illumina [1]

Mature sequence cgr-miR-92b-3p

Accession MIMAT0024012
Sequence

52 - 

uauugcacucgucccggccucc

 - 73

Get sequence
Deep sequencing34298 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).