Stem-loop sequence ggo-mir-381

AccessionMI0020767 (change log)
DescriptionGorilla gorilla miR-381 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
   ccugcccagugcuauu            a  c   g        u        --g   u 
5'                 guuugguacuua ag gag uugcccuu guauauuc   guu a
                   |||||||||||| || ||| |||||||| ||||||||   |||  
3'                 caaacuaugagu uc cuc aacgggaa cauauaag   cag u
   -----------uguuc            g  u   g        -        gua   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr14: 85068929-85069036 [+]
intergenic
Clustered miRNAs
< 10kb from ggo-mir-381
ggo-mir-376cchr14: 85062699-85062808 [+]
ggo-mir-654chr14: 85063234-85063342 [+]
ggo-mir-376bchr14: 85063462-85063571 [+]
ggo-mir-376achr14: 85063790-85063899 [+]
ggo-mir-1185chr14: 85067224-85067333 [+]
ggo-mir-381chr14: 85068929-85069036 [+]
ggo-mir-487bchr14: 85069466-85069575 [+]
ggo-mir-539chr14: 85070357-85070418 [+]
ggo-mir-889chr14: 85070907-85071016 [+]
ggo-mir-655chr14: 85072564-85072671 [+]
ggo-mir-487achr14: 85075456-85075565 [+]
ggo-mir-382chr14: 85077348-85077404 [+]
ggo-mir-134chr14: 85077719-85077791 [+]
ggo-mir-668chr14: 85078261-85078371 [+]
ggo-mir-485chr14: 85078439-85078547 [+]
Database links

Mature sequence ggo-miR-381

Accession MIMAT0024220
Sequence

71 - 

uauacaagggcaagcucucug

 - 91

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).