Stem-loop sequence nta-MIR6152b

AccessionMI0021442 (change log)
DescriptionNicotiana tabacum miR6152b stem-loop
Gene family MIPF0001607; MIR6152
Stem-loop
   -----cu   ca a       a  c  c  u      --gg   ----       ggg 
5'        gga  g uuauugu uu ga ug auucac    cau    gaaauag   a
          |||  | ||||||| || || || ||||||    |||    |||||||   u
3'        ccu  c gauaaua aa uu ac uaagug    gua    uuuuguc   u
   auauaau   -- a       c  -  a  -      aaag   aaau       aua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR6152b

Accession MIMAT0024752
Sequence

11 - 

uauuguauucgacuguauucacgg

 - 34

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).