Stem-loop sequence ptc-MIR6463

AccessionMI0021969 (change log)
DescriptionPopulus trichocarpa miR6463 stem-loop
Stem-loop
      -     g    uc   ggca     -    u    u            c        uuau   u       gguu   uuaag  agc      g 
5' cau uguag acau  guc    accau uuag caug uugcuaacauga cguccaag    caa uauguca    aca     ga   uggcau a
   ||| ||||| ||||  |||    ||||| |||| |||| |||||||||||| ||||||||    ||| |||||||    |||     ||   ||||||  
3' gua gcguc ugua  uag    uggug aguu guac aacgguuguacu guagguuc    guu guacagu    ugu     cu   accgua g
      u     g    -c   ---a     u    -    c            a        uacu   u       ----   ugaaa  ---      c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000340.2: 6132645-6132830 [+]
intergenic
Database links

Mature sequence ptc-miR6463

Accession MIMAT0025189
Sequence

134 - 

uggaugaucauguuggcaacc

 - 154

Get sequence
Evidence experimental; miRNAseq [1], Illumina [2]

References

1
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).
2