Stem-loop sequence ptc-MIR6430

AccessionMI0022004 (change log)
DescriptionPopulus trichocarpa miR6430 stem-loop
Stem-loop
   ---cca       -    ----u  u                  a           a       -      uu 
5'       aucuuag cuuc     ug uguuuagcuugaugauua uugacugcaaa gcaacuc ucuucu  u
         ||||||| ||||     || |||||||||||||||||| ||||||||||| ||||||| ||||||   
3'       uggaguc ggag     ac auaaaucgaacuacuaau aacugacguuu cguugag agagga  u
   ggaaga       a    ucaau  c                  g           c       g      uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000337.2: 34025493-34025631 [+]
intergenic
Database links

Mature sequence ptc-miR6430

Accession MIMAT0025231
Sequence

28 - 

ugaugauuaauugacugcaaa

 - 48

Get sequence
Evidence experimental; miRNAseq [1], Illumina [2]

References

1
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).
2