Stem-loop sequence gga-mir-6562

AccessionMI0022542 (change log)
DescriptionGallus gallus miR-6562 stem-loop
Stem-loop
   u    uguag u  g   u     -      -a        u    u    --g a 
5'  cuuu     c cc gag ucuug uagggg  aaggaaug gcug ggug   g a
    ||||     | || ||| ||||| ||||||  |||||||| |||| ||||   | u
3'  ggag     g gg cuc aggac gucucu  uucuuuac ugac ccgc   c u
   g    uccua u  g   u     u      cg        -    u    aga u 
Get sequence
Deep sequencing
324 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr2: 82060204-82060313 [-]
intergenic
AADN04001314.1: 25332-25441 [+]
intergenic
Database links

Mature sequence gga-miR-6562-5p

Accession MIMAT0025832
Sequence

26 - 

aggggaaaggaaugugcugugg

 - 47

Get sequence
Deep sequencing44 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6562-3p

Accession MIMAT0025833
Sequence

65 - 

ucagucauuucuugcucucugu

 - 86

Get sequence
Deep sequencing26 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).