Stem-loop sequence ccr-mir-25

AccessionMI0023381 (change log)
DescriptionCyprinus carpio miR-25 stem-loop
Gene family MIPF0000013; mir-25
Literature search

2 open access papers mention ccr-mir-25
(2 sentences)

Stem-loop
   ---------ua     ug   ag    g     uu g     u   ----  c 
5'            gcugg  uug  aggc gagac  g gcagu gcu    gg u
              |||||  |||  |||| |||||  | ||||| |||    || u
3'            cggcc  gac  ucug cucug  c cguua cgg    cc u
   ucuacucaaca     gu   ag    g     uu a     -   aaca  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-25

Accession MIMAT0026280
Sequence

53 - 

cauugcacuugucucggucuga

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).