Stem-loop sequence ccr-mir-92a

AccessionMI0023419 (change log)
DescriptionCyprinus carpio miR-92a stem-loop
Gene family MIPF0000013; mir-25
Literature search

1 open access papers mention ccr-mir-92a
(1 sentences)

Stem-loop
   a    -  -    ug           c  cc        -  g 
5'  uccc ug ucuu  cagguugggau gg  gcaaugcu cu c
    |||| || ||||  ||||||||||| ||  |||||||| || g
3'  aggg ac agaa  guccggcccug uc  cguuauga gg c
   -    c  g    gu           u  -a        a  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-92a

Accession MIMAT0026323
Sequence

50 - 

uauugcacuugucccggccugu

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).