Stem-loop sequence mmu-mir-6516

AccessionMI0022266 (change log)
Symbol MGI:Mir6516
DescriptionMus musculus miR-6516 stem-loop
Gene family MIPF0001672; mir-6516
Literature search

1 open access papers mention mmu-mir-6516
(2 sentences)

Stem-loop
   -----aaccucuucccug     agaa         a  g ug  ga    cu   a 
5'                   ggguu    uuugcagua ca g  ug  cauc  agc g
                     |||||    ||||||||| || |  ||  ||||  |||  
3'                   cccga    aaacgucau gu u  ac  gugg  uug c
   caggggugucgaagucgu     ggac         a  a gu  ug    -u   a 
Get sequence
Deep sequencing
1369 reads, 2.35 reads per million, 85 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 117077348-117077457 [+]
sense
OTTMUST00000008300 ; RP23-41E14.4-001; intron 1
OTTMUST00000116901 ; RP23-41E14.4-006; exon 1
OTTMUST00000086892 ; RP23-41E14.4-002; exon 2
ENSMUST00000182811 ; 2810008D09Rik-006; exon 1
ENSMUST00000149822 ; 2810008D09Rik-001; intron 1
ENSMUST00000157904 ; Gm26083-201; exon 1
ENSMUST00000145438 ; 2810008D09Rik-002; exon 2
Database links

Mature sequence mmu-miR-6516-5p

Accession MIMAT0027343
Sequence

23 - 

uuugcaguaacagguguggaca

 - 44

Get sequence
Deep sequencing956 reads, 79 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mmu-miR-6516-3p

Accession MIMAT0027344
Sequence

65 - 

ucauguaugauacugcaaacag

 - 86

Get sequence
Deep sequencing405 reads, 43 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22844398 "Novel microRNAs differentially expressed during aging in the mouse brain" Inukai S, de Lencastre A, Turner M, Slack F PLoS One. 7:e40028(2012).