Stem-loop sequence mmu-mir-6928

AccessionMI0022775 (change log)
Symbol MGI:Mir6928
DescriptionMus musculus miR-6928 stem-loop
Stem-loop
   uuccaa     uu    u    u  ac  -a     u 
5'       gggga  ugca ggac gc  ua  gacac u
         |||||  |||| |||| ||  ||  |||||  
3'       ccucu  augu cuug cg  au  uugug c
   ----ga     -c    c    u  aa  cc     a 
Get sequence
Deep sequencing
350 reads, 0 reads per million, 41 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 101030340-101030409 [+]
sense
OTTMUST00000004308 ; Atp6v0a1-003; intron 7
OTTMUST00000004309 ; Atp6v0a1-004; intron 7
OTTMUST00000004306 ; Atp6v0a1-001; intron 8
OTTMUST00000004307 ; Atp6v0a1-002; intron 8
ENSMUST00000154896 ; Atp6v0a1-004; intron 7
ENSMUST00000092663 ; Atp6v0a1-003; intron 7
ENSMUST00000044721 ; Atp6v0a1-001; intron 8
ENSMUST00000103110 ; Atp6v0a1-002; intron 8
ENSMUST00000168757 ; Atp6v0a1-201; intron 8
Database links

Mature sequence mmu-miR-6928-5p

Accession MIMAT0027756
Sequence

6 - 

aggggauuugcauggacugcacu

 - 28

Get sequence
Deep sequencing39 reads, 21 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6928-3p

Accession MIMAT0027757
Sequence

49 - 

aagcuguuccuguacucuccag

 - 70

Get sequence
Deep sequencing310 reads, 32 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).