Stem-loop sequence mmu-mir-6971

AccessionMI0022819 (change log)
Symbol MGI:Mir6971
DescriptionMus musculus miR-6971 stem-loop
Literature search

2 open access papers mention mmu-mir-6971
(2 sentences)

Stem-loop
   uggggugg       u          -  c   c 
5'         gggaggg guagaggcug gg ugg a
           ||||||| |||||||||| || ||| g
3'         cucuucu cgucuccgac cu acu a
   ------ga       u          a  -   c 
Get sequence
Deep sequencing
56 reads, 0 reads per million, 27 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr17: 34841809-34841871 [-]
sense
OTTMUST00000096095 ; Skiv2l-011; intron 2
OTTMUST00000096096 ; Skiv2l-010; intron 3
OTTMUST00000096092 ; Skiv2l-004; intron 15
OTTMUST00000096089 ; Skiv2l-002; intron 18
OTTMUST00000096091 ; Skiv2l-003; intron 18
OTTMUST00000096090 ; Skiv2l-001; intron 19
ENSMUST00000173415 ; Skiv2l-011; intron 2
ENSMUST00000172878 ; Skiv2l-010; intron 3
ENSMUST00000174363 ; Skiv2l-004; intron 15
ENSMUST00000174226 ; Skiv2l-002; intron 18
ENSMUST00000174887 ; Skiv2l-003; intron 18
ENSMUST00000046022 ; Skiv2l-001; intron 19
Clustered miRNAs
< 10kb from mmu-mir-6971
mmu-mir-6970chr17: 34845101-34845167 [-]
mmu-mir-6971chr17: 34841809-34841871 [-]
Database links

Mature sequence mmu-miR-6971-5p

Accession MIMAT0027844
Sequence

6 - 

ugggggaggguguagaggcu

 - 25

Get sequence
Deep sequencing20 reads, 10 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6971-3p

Accession MIMAT0027845
Sequence

43 - 

acagccucugcuucuucucag

 - 63

Get sequence
Deep sequencing25 reads, 19 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).