Stem-loop sequence mmu-mir-6990

AccessionMI0022838 (change log)
Symbol MGI:Mir6990
DescriptionMus musculus miR-6990 stem-loop
Stem-loop
   gcu    c    u   u         --------   g   ucu      c 
5'    ugcc aggg gag cagggcucu        ccu uca   gggccc c
      |||| |||| ||| |||||||||        ||| |||   |||||| u
3'    acgg uccu cuc gucccgagg        gga ggu   cucggg c
   --g    -    u   c         ucaccgcc   g   ---      c 
Get sequence
Deep sequencing
202 reads, 93.3 reads per million, 60 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr19: 6914196-6914286 [-]
sense
OTTMUST00000098347 ; Esrra-005; intron 1
OTTMUST00000056137 ; Esrra-001; intron 2
OTTMUST00000098348 ; Esrra-004; exon 2
ENSMUST00000173635 ; Esrra-005; intron 1
ENSMUST00000025906 ; Esrra-001; intron 2
ENSMUST00000173308 ; Esrra-004; exon 2
Database links

Mature sequence mmu-miR-6990-5p

Accession MIMAT0027882
Sequence

6 - 

cccagggugagucagggcucu

 - 26

Get sequence
Deep sequencing166 reads, 51 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6990-3p

Accession MIMAT0027883
Sequence

71 - 

agcccugccucuuccuggcag

 - 91

Get sequence
Deep sequencing25 reads, 18 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).