Stem-loop sequence dev-mir-D12

AccessionMI0023591 (change log)
DescriptionDuck enteritis virus miR-D12 stem-loop
Stem-loop
        ac       aga       cc  g   ag 
5' gcuuu  cugggac   accgcgg  gc uag  a
   |||||  |||||||   |||||||  || |||   
3' cgaaa  gacccug   uggcgcc  cg auc  a
        --       gag       -u  -   aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence dev-miR-D12-5p

Accession MIMAT0028184
Sequence

5 - 

uaccugggacagaaccgcggccg

 - 27

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dev-miR-D12-3p

Accession MIMAT0028185
Sequence

43 - 

cuccgcggugaggucccagaaa

 - 64

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22492913 "Novel microRNAs encoded by duck enteritis virus" Yao Y, Smith LP, Petherbridge L, Watson M, Nair V J Gen Virol. 93:1530-1536(2012).