Stem-loop sequence lja-MIR171d

AccessionMI0024380 (change log)
DescriptionLotus japonicus miR171d stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

2 open access papers mention lja-MIR171d
(8 sentences)

Stem-loop
         - c          a            a  -  -ga     a  aa 
5' gagaaa g gauguuggug gguucaaucuga ga cg   uuuac ug  g
   |||||| | |||||||||| |||||||||||| || ||   ||||| ||   
3' uucuuu c cuauaaccgc ccgaguuagacu cu gc   aaaug ac  a
         u a          g            -  a  aua     -  ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (lj2.5) Overlapping transcripts
Chr4: 27721691-27721789 [+]
intergenic
Database links

Mature sequence lja-miR171d-3p

Accession MIMAT0029317
Sequence

8 - 

cgauguuggugagguucaauc

 - 28

Get sequence
Evidence experimental; cloned [1]

Mature sequence lja-miR171d-5p

Accession MIMAT0029318
Sequence

73 - 

uugagccgcgccaauaucacu

 - 93

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:23071252 "Two microRNAs linked to nodule infection and nitrogen-fixing ability in the legume Lotus japonicus" De Luis A, Markmann K, Cognat V, Holt DB, Charpentier M, Parniske M, Stougaard J, Voinnet O Plant Physiol. 160:2137-2154(2012).