Stem-loop sequence ipu-mir-363

AccessionMI0024625 (change log)
DescriptionIctalurus punctatus miR-363 stem-loop
Gene family MIPF0000138; mir-363
Stem-loop
   --u          a  c         auuag   u ga 
5'    cggguggaug cu ugcaauuuu     uga g  a
      |||||||||| || |||||||||     ||| |   
3'    gucuaccuau gg acguuaaaa     acu c  a
   aau          -  c         --aua   u aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-363

Accession MIMAT0029506
Sequence

51 - 

aauugcacgguauccaucuguaa

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1