Stem-loop sequence ipu-mir-92b

AccessionMI0024666 (change log)
DescriptionIctalurus punctatus miR-92b stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   --    g       uu           uucaa 
5'   aggu ugggaug  gugcaguguug     u
     |||| |||||||  |||||||||||     c
3'   uccg gcccugc  cacguuauaac     u
   cc    -       -u           cgccc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-92b

Accession MIMAT0029530
Sequence

42 - 

uauugcacucgucccggccucc

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1