Stem-loop sequence cbn-mir-64j-1

AccessionMI0024848 (change log)
DescriptionCaenorhabditis brenneri miR-64j-1 stem-loop
Gene family MIPF0000295; mir-64
Stem-loop
   -g   a   uu u    u  c     uucuc 
5'   aug cac  g auag ca gguug     u
     ||| |||  | |||| || |||||     a
3'   uac gug  c uauc gu ccaac     a
   ga   c   uu -    c  -     uuuua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (C_brenneri-6.0.1b; GCA_000143925.2) Overlapping transcripts
Cbre_Contig274: 39823-39884 [-]
intergenic
Clustered miRNAs
< 10kb from cbn-mir-64j-1
cbn-mir-64j-1Cbre_Contig274: 39823-39884 [-]
cbn-mir-64fCbre_Contig274: 39560-39625 [-]
cbn-mir-64b-1Cbre_Contig274: 39431-39495 [-]
cbn-mir-64h-1Cbre_Contig274: 39311-39375 [-]
cbn-mir-64a-5Cbre_Contig274: 39182-39246 [-]
cbn-mir-64d-1Cbre_Contig274: 39055-39119 [-]
cbn-mir-64eCbre_Contig274: 38928-38992 [-]
cbn-mir-64b-2Cbre_Contig274: 38801-38865 [-]
cbn-mir-64c-2Cbre_Contig274: 38550-38614 [-]
cbn-mir-64a-2Cbre_Contig274: 38399-38463 [-]
cbn-mir-64i-2Cbre_Contig274: 38272-38338 [-]
cbn-mir-64g-2Cbre_Contig274: 38025-38086 [-]
cbn-mir-64k-1Cbre_Contig274: 37911-37974 [-]
cbn-mir-64lCbre_Contig274: 37788-37847 [-]
Database links

Mature sequence cbn-miR-64j

Accession MIMAT0029698
Sequence

1 - 

gaugacacuuguauagucacgguug

 - 25

Get sequence
Evidence experimental; Illumina [1]

References

1