Stem-loop sequence bdi-MIR7743

AccessionMI0025361 (change log)
DescriptionBrachypodium distachyon miR7743 stem-loop
Stem-loop
   -----  ug    uu  c     c  --au    ug cu     uuu g     a c    ucuu    ug      
5'      au  gaaa  ag aucua ug    aguu  a  gcaug   g aaauu g auau    ucua  gguuc 
        ||  ||||  || ||||| ||    ||||  |  |||||   | ||||| | ||||    ||||  |||| u
3'      ug  cuuu  uc uaggu au    ucaa  u  uguau   c uuuaa c uaug    aggu  ucaga 
   aagau  gu    --  -     u  guuu    gu -u     -cu g     a a    ---u    uu      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
5: 17786144-17786281 [+]
intergenic
Database links

Mature sequence bdi-miR7743-5p

Accession MIMAT0030226
Sequence

11 - 

agcaucuacugauaguuugacugc

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7743-3p

Accession MIMAT0030227
Sequence

104 - 

uuugaacuuuuguauuggaucuuu

 - 127

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).