Stem-loop sequence prd-mir-46

AccessionMI0025575 (change log)
DescriptionPanagrellus redivivus miR-46 stem-loop
Gene family MIPF0000087; mir-46
Stem-loop
   -        -ca     u      uugccu 
5'  aagagagc   ucugu gacagu      u
    ||||||||   ||||| ||||||       
3'  uucucucg   aggua cuguca      u
   a        uug     -      uuaaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pred3; GCA_000341325.1) Overlapping transcripts
KB455535.1: 288919-288977 [+]
intergenic
Database links

Mature sequence prd-miR-46-5p

Accession MIMAT0030508
Sequence

1 - 

aagagagccaucuguugacagu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence prd-miR-46-3p

Accession MIMAT0030509
Sequence

39 - 

ugucauggaguugcucucuua

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23410827 "The draft genome and transcriptome of Panagrellus redivivus are shaped by the harsh demands of a free-living lifestyle" Srinivasan J, Dillman AR, Macchietto MG, Heikkinen L, Lakso M, Fracchia KM, Antoshechkin I, Mortazavi A, Wong G, Sternberg PW Genetics. 193:1279-1295(2013).