Stem-loop sequence aja-mir-3596

AccessionMI0024356 (change log)
DescriptionArtibeus jamaicensis miR-3596 stem-loop
Stem-loop
   a   -c      -a   caa              aucuccugaacaggg 
5'  cuc  ucaggg  agg   uagauuguauaguu               u
    |||  ||||||  |||   ||||||||||||||                
3'  gag  agucuc  ucc   aucuaacauaucaa               a
   -   au      ac   auc              caccccaucaauaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence aja-miR-3596

Accession MIMAT0031134
Sequence

67 - 

cuauacaaucuacuaccuca

 - 86

Get sequence
Evidence not experimental

References

1
PMID:23166587 "Transcriptome sequencing and annotation for the Jamaican fruit bat (Artibeus jamaicensis)" Shaw TI, Srivastava A, Chou WC, Liu L, Hawkinson A, Glenn TC, Adams R, Schountz T PLoS One. 7:e48472(2012).