Stem-loop sequence aja-mir-331

AccessionMI0024372 (change log)
DescriptionArtibeus jamaicensis miR-331 stem-loop
Gene family MIPF0000199; mir-331
Stem-loop
   gaguuugguuuu         u        u    u       au ccaga 
5'             guuuggguu guucuagg augg cccaggg  c     u
               ||||||||| |||||||| |||| |||||||  |     c
3'             caaauccaa caagaucc uauc ggguccc  g     a
   ------------         c        -    c       cg accaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence aja-miR-331

Accession MIMAT0031150
Sequence

61 - 

gccccugggccuauccuagaa

 - 81

Get sequence
Evidence not experimental

References

1
PMID:23166587 "Transcriptome sequencing and annotation for the Jamaican fruit bat (Artibeus jamaicensis)" Shaw TI, Srivastava A, Chou WC, Liu L, Hawkinson A, Glenn TC, Adams R, Schountz T PLoS One. 7:e48472(2012).