Stem-loop sequence bbe-mir-2063

AccessionMI0026207 (change log)
DescriptionBranchiostoma belcheri miR-2063 stem-loop
Gene family MIPF0001752; mir-2063
Stem-loop
   agggu           a     -a   u        gguu    ac 
5'      uacuuucaaaa gcaaa  agu gcaauauc    uacg  g
        ||||||||||| |||||  ||| ||||||||    ||||   
3'      gugaaaguuuu cguuu  uca cguuauag    augc  u
   -----           -     aa   -        ----    au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bbe-miR-2063-3p

Accession MIMAT0031625
Sequence

13 - 

aaaaagcaaaaaguugcaauau

 - 34

Get sequence
Evidence not experimental

Mature sequence bbe-miR-2063-5p

Accession MIMAT0031626
Sequence

56 - 

uauugcacuaauuugcuuuuga

 - 77

Get sequence
Evidence not experimental

References

1
PMID:23335747 "Genome-wide analyses of amphioxus microRNAs reveal an immune regulation via miR-92d targeting C3" Yang R, Zheng T, Cai X, Yu Y, Yu C, Guo L, Huang S, Zhu W, Zhu R, Yan Q, Ren Z, Chen S, Xu A J Immunol. 190:1491-1500(2013).