Stem-loop sequence sma-mir-2d

AccessionMI0021823 (change log)
DescriptionSchistosoma mansoni miR-2d stem-loop
Gene family MIPF0000049; mir-2
Literature search

4 open access papers mention sma-mir-2d
(11 sentences)

Stem-loop
      cc         u   ----u          u   -cgaa    a 
5' cga  aguucguca ccu     ggauugugau uuc     auaa a
   |||  ||||||||| |||     |||||||||| |||     ||||  
3' gcu  uuaagcagu gga     ccugacacua aag     uauu u
      --         -   uucgu          u   auaag    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WTSI5) Overlapping transcripts
Chr_5: 1982526-1982613 [-]
intergenic
Clustered miRNAs
< 10kb from sma-mir-2d
sma-mir-71bChr_5: 1982759-1982850 [-]
sma-mir-2fChr_5: 1982640-1982726 [-]
sma-mir-2dChr_5: 1982526-1982613 [-]
sma-mir-2cChr_5: 1982423-1982497 [-]
Database links

Mature sequence sma-miR-2d-5p

Accession MIMAT0032135
Sequence

11 - 

gucauccuuggauugugauu

 - 30

Get sequence
Evidence experimental; Illumina [2], SOLiD [2]

Mature sequence sma-miR-2d-3p

Accession MIMAT0025035
Sequence

58 - 

uaucacaguccugcuuagguga

 - 79

Get sequence
Evidence experimental; Illumina [2], SOLiD [2]

References

1
PMID:21640815 "Genome-wide identification of novel microRNAs and their target genes in the human parasite Schistosoma mansoni" de Souza Gomes M, Muniyappa MK, Carvalho SG, Guerra-Sa R, Spillane C Genomics. 98:96-111(2011).
2
PMID:24069470 "Sex-biased expression of microRNAs in Schistosoma mansoni" Marco A, Kozomara A, Hui JH, Emery AM, Rollinson D, Griffiths-Jones S, Ronshaugen M PLoS Negl Trop Dis. 7:e2402(2013).