Stem-loop sequence rgl-MIR7803b

AccessionMI0025461 (change log)
DescriptionRehmannia glutinosa miR7803b stem-loop
Stem-loop
   -    -  g            c                   a    -----ca    - ua 
5'  ucua cc cauggaugauug cacguguauaauacuuacc uguu       aagc c  c
    |||| || |||||||||||| ||||||||||||||||||| ||||       |||| |  a
3'  aggu gg guaucuacuaac gugcacauauugugaaugg auaa       uucg g  a
   a    u  a            u                   c    uuaacag    u uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rgl-miR7803b-5p

Accession MIMAT0032252
Sequence

11 - 

ggaugauugccacguguaua

 - 30

Get sequence
Evidence experimental; Illumina [1]

Mature sequence rgl-miR7803b-3p

Accession MIMAT0032253
Sequence

88 - 

uacacgugucaaucaucuau

 - 107

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23861915 "Transcriptome/degradome-wide identification of R. glutinosa miRNAs and their targets: the role of miRNA activity in the replanting disease" Li MJ, Yang YH, Chen XJ, Wang FQ, Lin WX, Yi YJ, Zeng L, Yang SY, Zhang ZY PLoS One. 8:e68531(2013).