Stem-loop sequence ssa-mir-153a-2

AccessionMI0026518 (change log)
DescriptionSalmo salar miR-153a-2 stem-loop
Gene family MIPF0000050; mir-153
Stem-loop
   --    c         -       a uagu 
5'   ucau uuugugauu ugcagcu g    c
     |||| ||||||||| ||||||| |     
3'   agua aaacacuga acguuga c    u
   cu    a         u       c uggg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-153a-2-5p

Accession MIMAT0032389
Sequence

1 - 

ucaucuuugugauuugcagcu

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-153a-3p

Accession MIMAT0032388
Sequence

38 - 

uugcauagucacaaaaaugauc

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1