Stem-loop sequence ppc-mir-63i

AccessionMI0026861 (change log)
DescriptionPristionchus pacificus miR-63i stem-loop
Gene family MIPF0000823; mir-63
Stem-loop
   --c   u      c           -  -  au 
5'    cgc cacuug agugucauggu cc uc  u
      ||| |||||| ||||||||||| || ||   
3'    gcg gugaac ucacaguauca gg ag  u
   gga   c      -           u  u  gg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000028.1: 915024-915086 [+]
intergenic
Clustered miRNAs
< 10kb from ppc-mir-63i
ppc-mir-63gABKE03000028.1: 914719-914813 [+]
ppc-mir-63iABKE03000028.1: 915024-915086 [+]
ppc-mir-63hABKE03000028.1: 915178-915286 [+]
ppc-mir-63dABKE03000028.1: 915392-915493 [+]
ppc-mir-63kABKE03000028.1: 915983-916046 [+]
ppc-mir-63eABKE03000028.1: 916252-916352 [+]
Database links

Mature sequence ppc-miR-63i-5p

Accession MIMAT0032868
Sequence

1 - 

ccgcucacuugcagugucauggu

 - 23

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

Mature sequence ppc-miR-63i-3p

Accession MIMAT0032869
Sequence

42 - 

uaugacacucaagugcgcgagg

 - 63

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).