Stem-loop sequence ppc-mir-8232

AccessionMI0026883 (change log)
DescriptionPristionchus pacificus miR-8232 stem-loop
Stem-loop
   --u         -     a c    ----     c 
5'    gucauucug ucccg g gacc    ugugc a
      ||||||||| ||||| | ||||    |||||  
3'    cggugagac agggc c cugg    acacg c
   cau         g     - a    uucg     c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ppc-miR-8232-5p

Accession MIMAT0032912
Sequence

1 - 

ugucauucugucccgagcgacc

 - 22

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

Mature sequence ppc-miR-8232-3p

Accession MIMAT0032913
Sequence

43 - 

ucaccgggagcagaguggcuac

 - 64

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).