Stem-loop sequence gra-MIR7492k

AccessionMI0027723 (change log)
DescriptionGossypium raimondii miR7492k stem-loop
Gene family MIPF0001661; MIR7492
Stem-loop
   -       ag     au              gu 
5'  cgcuaaa  ucgug  cuuuagcggcguuu  g
    |||||||  |||||  ||||||||||||||  a
3'  gcgauuu  aguac  gaaaucgccgcgaa  u
   g       cu     cg              aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Graimondii2_0; GCA_000327365.1) Overlapping transcripts
chr11: 24191919-24191986 [-]
intergenic
Database links

Mature sequence gra-miR7492k

Accession MIMAT0034128
Sequence

11 - 

cgugaucuuuagcggcguuug

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1