Stem-loop sequence gra-MIR7494e

AccessionMI0027768 (change log)
DescriptionGossypium raimondii miR7494e stem-loop
Gene family MIPF0001661; MIR7492
Stem-loop
   -               au              gu 
5'  ccgcuaaaggucgug  cuuuagcgguguuu  g
    |||||||||||||||  ||||||||||||||  a
3'  ggcgauuucuaguac  gaaaucgccgcgaa  u
   c               cg              aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Graimondii2_0; GCA_000327365.1) Overlapping transcripts
chr12: 14711186-14711255 [-]
intergenic
Database links

Mature sequence gra-miR7494e

Accession MIMAT0034173
Sequence

11 - 

ucgugaucuuuagcgguguuu

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1