Stem-loop sequence eca-mir-185

AccessionMI0028070 (change log)
DescriptionEquus caballus miR-185 stem-loop
Gene family MIPF0000202; mir-185
Stem-loop
   cug   agcg   -cu   u  a  ---a     u       ug   a     g         au  uc 
5'    ggc    ggc   ggc cg gu    ggggg gagggau  gag gaaag caguuccug  gg  c
      |||    |||   ||| || ||    ||||| |||||||  ||| ||||| |||||||||  ||   
3'    ccg    cug   cug gc ca    cccuu cuuccug  cuc cuuuc gucggggac  cc  c
   ---   -gaa   cuu   c  -  guaa     c       gu   -     g         -c  uc 
Get sequence
Deep sequencing
202 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
NW_001875797.1: 1055144-1055272 [+]
intergenic
Database links

Mature sequence eca-miR-185

Accession MIMAT0034461
Sequence

73 - 

caggggcuggcuuuccucuggu

 - 94

Get sequence
Deep sequencing9 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).