Stem-loop sequence efu-mir-9368

AccessionMI0028909 (change log)
DescriptionEptesicus fuscus miR-9368 stem-loop
Stem-loop
   -------   aucgc  u     aaa  -g       u   - gug 
5'        ggg     ga gggag   cc  gaguuug aga c   a
          |||     || |||||   ||  ||||||| ||| |    
3'        ccc     cu cccuu   gg  cucgagc ucu g   u
   ggcucau   -----  c     caa  ag       c   u ggg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0; GCA_000308155.1) Overlapping transcripts
JH977789.1: 746308-746387 [+]
intergenic
Database links

Mature sequence efu-miR-9368

Accession MIMAT0035195
Sequence

47 - 

uccgagcucgaggaacuuccccuc

 - 70

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).