Stem-loop sequence gsa-mir-281

AccessionMI0028953 (change log)
DescriptionGyrodactylus salaris miR-281 stem-loop
Stem-loop
   --          a    cu    --    a  cca 
5'   uggagggcaa cucu  ugac  guaa ga   a
     |||||||||| ||||  ||||  |||| ||    
3'   acuucucguu gagg  acug  cauu cu   g
   aa          -    -u    ua    a  aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence gsa-miR-281-5p

Accession MIMAT0035268
Sequence

1 - 

uggagggcaaacucucuugacgua

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence gsa-miR-281-3p

Accession MIMAT0035269
Sequence

45 - 

ugucauggaguugcucuucaaa

 - 66

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24025793 "Substantial loss of conserved and gain of novel MicroRNA families in flatworms" Fromm B, Worren MM, Hahn C, Hovig E, Bachmann L Mol Biol Evol. 30:2619-2628(2013).