Stem-loop sequence gma-MIR9746b

AccessionMI0031029 (change log)
DescriptionGlycine max miR9746b stem-loop
Gene family MIPF0001884; MIR9746
Stem-loop
   ac       c                       a     c          guuu 
5'   gguuauc aauugagauucaagcacuuuucu ugugg uuuaaggugu    g
     ||||||| ||||||||||||||||||||||| ||||| ||||||||||    a
3'   ccaauag uuaacucuaaguuugugaaaaga guacc aaauuccaca    a
   -a       a                       a     u          aggu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr3: 2840637-2840746 [+]
intergenic
Clustered miRNAs
< 10kb from gma-MIR9746b
gma-MIR9746achr3: 2836542-2836651 [+]
gma-MIR9746bchr3: 2840637-2840746 [+]
gma-MIR9746cchr3: 2849581-2849690 [+]
Database links

Mature sequence gma-miR9746b

Accession MIMAT0036367
Sequence

82 - 

aaaguguuugaaucucaauuagau

 - 105

Get sequence
Evidence experimental; Illumina [1]

References

1