Stem-loop sequence tch-mir-143

AccessionMI0031135 (change log)
DescriptionTupaia chinensis miR-143 stem-loop
Gene family MIPF0000094; mir-143
Stem-loop
   --  g         g      u  -  ag 
5'   ag ugcagugcu caucuc gg uc  u
     || ||||||||| |||||| || ||   
3'   uc augucacga guagag cu ag  u
   gc  g         a      u  g  gg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TupChi_1.0; GCA_000334495.1) Overlapping transcripts
KB320740.1: 862383-862439 [+]
intergenic
Database links

Mature sequence tch-miR-143-3p

Accession MIMAT0036476
Sequence

36 - 

ugagaugaagcacuguagcucg

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1