Stem-loop sequence oha-mir-124-2

AccessionMI0031324 (change log)
DescriptionOphiophagus hannah miR-124-2 stem-loop
Gene family MIPF0000021; mir-124
Stem-loop
     -u     cc        a   ga        uaaug 
5' cc  ucucu  guguucac gcg  ccuugauu     u
   ||  |||||  |||||||| |||  ||||||||      
3' gg  agaga  cguaagug cgc  ggaauuaa     c
     cu     ac        g   ac        cauac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OphHan1.0; GCA_000516915.1) Overlapping transcripts
AZIM01011395.1: 15888-15964 [-]
intergenic
Database links

Mature sequence oha-miR-124-5p

Accession MIMAT0036669
Sequence

10 - 

cguguucacagcggaccuugau

 - 31

Get sequence
Evidence not experimental

Mature sequence oha-miR-124-3p

Accession MIMAT0036670
Sequence

48 - 

uaaggcacgcggugaaugccaag

 - 70

Get sequence
Evidence not experimental

References

1
PMID:24297900 "The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system" Vonk FJ, Casewell NR, Henkel CV, Heimberg AM, Jansen HJ, McCleary RJ, Kerkkamp HM, Vos RA, Guerreiro I, Calvete JJ, Wuster W, Woods AE, Logan JM, Harrison RA, Castoe TA, de Koning AP, Pollock DD, Yandell M, Calderon D, Renjifo C, Currier RB, Salgado D, Pl Proc Natl Acad Sci U S A. 110:20651-20656(2013).