Stem-loop sequence oha-mir-200a

AccessionMI0031401 (change log)
DescriptionOphiophagus hannah miR-200a stem-loop
Gene family MIPF0000019; mir-8
Stem-loop
   gaucg   -  -    g        -             c    uuuugu 
5'      ugg uc cucu uggacauc uuacuagacagug ugga      c
        ||| || |||| |||||||| ||||||||||||| ||||       
3'      acc ag gaga auuuguag aauggucugucac aucu      a
   -ucaa   g  u    a        c             a    caugug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OphHan1.0; GCA_000516915.1) Overlapping transcripts
AZIM01000256.1: 133883-133980 [+]
intergenic
Clustered miRNAs
< 10kb from oha-mir-200a
oha-mir-200aAZIM01000256.1: 133883-133980 [+]
oha-mir-429AZIM01000256.1: 137861-137949 [+]
Database links

Mature sequence oha-miR-200a

Accession MIMAT0036807
Sequence

58 - 

uaacacugucugguaacgauguu

 - 80

Get sequence
Evidence not experimental

References

1
PMID:24297900 "The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system" Vonk FJ, Casewell NR, Henkel CV, Heimberg AM, Jansen HJ, McCleary RJ, Kerkkamp HM, Vos RA, Guerreiro I, Calvete JJ, Wuster W, Woods AE, Logan JM, Harrison RA, Castoe TA, de Koning AP, Pollock DD, Yandell M, Calderon D, Renjifo C, Currier RB, Salgado D, Pl Proc Natl Acad Sci U S A. 110:20651-20656(2013).