sort by

372 publications mentioning hsa-mir-181b-1 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-181b-1. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 559
Moreover, these changes are independent of potential regulation by MMP-14 expression/activity, which we have previously shown to be upregulated in macrophages on GM-CSF stimulation [10] or through regulation of MMP-14 expression by miR-181b or TIMP-3 (Online Figure I). [score:10]
Here, we demonstrate that miR-181b was overexpressed in symptomatic human atherosclerotic plaques and abdominal aortic aneurysms and correlated with decreased expression of predicted miR-181b targets, tissue inhibitor of metalloproteinase-3, and elastin. [score:9]
Furthermore, recombinant TIMP-3 displayed no additive inhibitory effect on proteolytic activity in plaques from miR-181b inhibitor -treated animals (Figure 2B), indicating that the miR-181b inhibition -associated increase in TIMP-3 expression was responsible for the diminished proteolytic activity observed in plaques from treated mice. [score:9]
Taken together, these findings demonstrate that miR-181b inhibition exerts a dual protective role on AAA progression, through augmenting TIMP-3 expression and directly increasing elastin expression. [score:8]
Inhibition of miR-181b Attenuates Mortality Rates in Timp3 [−/−]/ Apoe [−/−] Mice by Directly Stimulating Elastin Expression in VSMCs and AAAsTo test whether miR-181b inhibition protects from AAA progression through TIMP-3, we used Timp3 [−/−]/ Apoe [−/−] mice. [score:8]
Hence, our findings confirm TIMP-3 as an miR-181b target [13] and demonstrate that miR-181b serves as an important inhibitor of macrophage TIMP-3 protein expression, which is divergently regulated by colony-stimulating factors. [score:8]
Finally, and most importantly, miR-181b inhibition decreases atherosclerotic plaque formation in mouse mo dels, primarily through upregulation of macrophage TIMP-3 expression, whereas in aneurysm mo dels there is an additional effect on elastin production from VSMC that is supported by in vitro studies. [score:8]
MiR-181b Inhibition Stabilizes Atherosclerotic Plaques in Hypercholesterolemic Apoe [−/] [−] MiceGiven the above, we hypothesized that miR-181b inhibition may restore macrophage TIMP-3 expression and prevent the progression of atherosclerosis. [score:7]
A, Representative images and quantification of macrophage tissue inhibitor of metalloproteinase (TIMP)-3 expression as assessed by immunofluorescence staining of brachiocephalic artery plaques from scrambled control and miR-181b inhibitor -treated Apoe [−/−] mice, n=6 to 8/group, * P<0.05, 2-tailed Student t test, scale bar represents 50 μm and is applicable to both panels. [score:7]
Indeed, using a wild-type elastin-3′-untranslated region reporter expression vector, we observed that the miR-181b inhibitor increased promoter activity (P<0.01; Figure 8I). [score:7]
We present here novel in vivo findings that miR-181b inhibition reduces the progression of established atherosclerotic plaques and AAAs, mediated by increased expression of TIMP-3 in intraplaque and intra-aneurysm macrophages and elastin expression in VSMC. [score:7]
[61] However, effects on atherosclerosis and aneurysm were not assessed, although the authors did demonstrate that miR-181b overexpression in endothelial cells dramatically suppressed TIMP-3 expression. [score:7]
These findings show that miR-181b inhibition exerts protective effects on aneurysm formation/progression at multiple susceptible sites within the aorta, even in the absence of overt inflammation, implying additional beneficial effects of miR-181b inhibition independent of increased TIMP-3 protein expression. [score:7]
30, 36, 49, 50 TIMP-3 augmentation achieved through miR-181b inhibition undoubtedly suppresses the activity of MMPs that target elastin, including MMP-12. [score:7]
To confirm this, we deployed a loss of function strategy in GM-CSF macrophages, revealing that miR-181b inhibition restored TIMP-3 protein expression to comparable levels found in M-CSF macrophages (Figure 1D), whereas the mRNA level was significantly reduced (Figure 1E), implying restored TIMP3 translation. [score:7]
Quantitative polymerase chain reaction analysis of atherosclerotic vessels demonstrated reduced miR-181b expression in mice treated with the locked nucleic acid–miR-181b inhibitor controls (Online Figure VIII), inferring that the miR-181b inhibitor had pervaded the plaque/vessel wall. [score:7]
MiR Inhibition Stabilizes AAAs in Angiotensin II–Infused Apoe [−/−] MiceUsing the angiotensin II (Ang II)–induced mo del of AAA formation in Apoe [−/−] mice fed a high-fat diet, [20] we investigated the potential beneficial effects of miR-181b inhibition on the progression of infrarenal atherosclerotic AAAs by using the protocol described in Online Figure X. Treatment with an miR-181b inhibitor did not alter mean arterial blood pressure levels in response to Ang II infusion (Figure 4A) but significantly reduced the occurrence of AAAs to 48% from 86% in scrambled inhibitor-infused, control mice (Figure 4B). [score:7]
In concert with our previous findings 8– 10 and the in situ zymography in the present study, we predict that the activity of select MMPs, such as MMP-14, is retarded through miR-181b–dependent TIMP-3 upregulation, although TIMP-3 can inhibit the activity of multiple MMPs, ADAMs, and aggrecanases (ADAMTS-4 and -5), the individual roles/activities of which were not determined in the current study. [score:6]
Moreover, we discover that miR-181b regulates macrophage TIMP-3 expression and that while miR-181b increases during the progression of atherosclerotic plaques and aneurysms, TIMP-3 protein expression diminishes. [score:6]
We determined that miR-181b negatively regulates macrophage tissue inhibitor of metalloproteinase-3 expression and vascular smooth muscle cell elastin production, both important factors in maintaining atherosclerotic plaque and aneurysm stability. [score:6]
First, we show that miR-181b mediates the downregulation by GM-CSF of macrophage TIMP-3 protein expression. [score:6]
D, Quantification of miR-181b expression by quantitative polymerase chain reaction (Q-PCR) and (E) tissue inhibitor of metalloproteinase (TIMP)-3 protein expression by immunohistochemistry, n=6 to 8/group, ** P<0.01 compared with scrambled control mice, 2-tailed Student t test. [score:6]
Consistent with a lack of effect on plaque area, miR-181b inhibition failed to modulate plaque components, such as smooth muscle cell, macrophage, and collagen content, or necrotic core size in Timp3 [−] [/−]/ Apoe [−] [/−] mice (Figure 3), in direct contrast to the beneficial effects observed in miR-181b inhibitor -treated Apoe [−/−] mice (Figure 2). [score:6]
This indicates that elastin stabilization by either TIMP-3–directed MMP inhibition or increased elastin synthesis is both afforded by miR-181b inhibition. [score:6]
However, modulation of plaque elastin content and fragmentation suggest TIMP-3–independent effects of miR-181b inhibition, implying that miR-181b may regulate other targets during atherosclerosis that influence elastin content. [score:6]
Figure 3. MicroRNA (miR)-181b inhibition does not affect plaque progression in the absence of tissue inhibitor of metalloproteinase (TIMP)-3. Representative images and quantification of plaque cross-sectional area in elastin van Gieson (EVG)–stained sections of plaques within (A) the aortic root or (B) the brachiocephalic artery of Timp3 [+/+] Apoe [−/−], Timp3 [−/−] Apoe [−/−], and miR-181b inhibitor -treated Timp3 [−/−] Apoe [−/−] mice, n=6 to 8/group, * P<0.05 and ** P<0.01 compared with Timp3 [+/+] Apoe [−/−] control animals, ANOVA, scale bar represents 100 μm and is applicable to all panels. [score:6]
Inhibition of miR-181b Attenuates Mortality Rates in Timp3 [−/−]/ Apoe [−/−] Mice by Directly Stimulating Elastin Expression in VSMCs and AAAs. [score:6]
Wang B Hsu SH Majumder S Kutay H Huang W Jacob ST Ghoshal K TGFbeta -mediated upregulation of hepatic miR-181b promotes hepatocarcinogenesis by targeting TIMP3. [score:6]
Collectively, these findings support the development of clinically applicable strategies to inhibit miR-181b, thereby maintaining or elevating TIMP-3 and elastin expression, and reducing elastin degradation. [score:6]
To assess whether miR-181b inhibition modulates atherosclerotic plaque progression through TIMP-3, we measured plaque development in Apoe/Timp3 double knockout (Timp3 [−] [/−]/ Apoe [−] [/−]) mice and whether miR-181b inhibition retarded the progression of preexisting lesions, as observed in Apoe knockout mice. [score:6]
Moreover, miR-181b inhibition greatly increased elastin and collagen expression, promoting a fibrotic response and subsequent stabilization of existing plaques and aneurysms. [score:5]
Validation studies in Timp3 [−/−] mice confirmed that the beneficial effects afforded by miR-181b inhibition are largely tissue inhibitor of metalloproteinase-3 dependent, while also revealing an additional protective effect through elevating elastin synthesis. [score:5]
Using the angiotensin II (Ang II)–induced mo del of AAA formation in Apoe [−/−] mice fed a high-fat diet, [20] we investigated the potential beneficial effects of miR-181b inhibition on the progression of infrarenal atherosclerotic AAAs by using the protocol described in Online Figure X. Treatment with an miR-181b inhibitor did not alter mean arterial blood pressure levels in response to Ang II infusion (Figure 4A) but significantly reduced the occurrence of AAAs to 48% from 86% in scrambled inhibitor-infused, control mice (Figure 4B). [score:5]
Other differences noted included the following: decreased AAA severity (Figure 4C), lowered abdominal aortic miR-181b expression by quantitative polymerase chain reaction (40%; Figure 4D), increased TIMP-3 protein expression (Figure 4E), significantly smaller mean maximal abdominal aortic diameters from histology (Figure 4F and 4G), and markedly more elastin (Figure 4G and 4H). [score:5]
However, our in vitro, in vivo, and human pathological experiments demonstrate a dominant role of TIMP-3 in protecting from disease progression subsequent to miR-181b inhibition. [score:5]
J, Representative Western blot and quantification of elastin protein expression in human aortic smooth muscle cells after addition of an miR-181b inhibitor or a scrambled control, n=4. [score:5]
Addition of an miR-181b inhibitor to aortic VSMCs significantly increased elastin protein expression (2.6-fold, P<0.01; Figure 8J). [score:5]
Similar to Apoe [−/−] mice, we observed a significant suppression in plaque progression as observed by a reduction in lesion area of miR-181b inhibitor -treated mice versus controls (by 67%; P<0.05; Online Figure IV), indicating that this effect is not exclusive to the Apoe [−/] [−] mouse mo del. [score:5]
These results demonstrate that administration of an miR-181b inhibitor augments TIMP-3 expression in AAAs, and this is associated with fewer and more stable aneurysms. [score:5]
Together, these data indicate that the majority of the beneficial actions of miR-181b inhibition on existing atherosclerotic plaques are through restoring macrophage TIMP-3 expression, as most effects were abolished in mice with Timp3 deficiency. [score:5]
Third, miR-181b through TIMP-3 downregulation is a key regulator of numerous macrophage functions involved in plaque and aneurysm progression, including increased MMP activity, macrophage invasion and accumulation, proliferation, and apoptosis. [score:5]
Interestingly, elastin content was increased in AAAs of miR-181b inhibitor -treated Timp3 [−/−]/ Apoe [−/−] mice (Figure 8F and 8G), implying that miR-181b modulates elastin expression within AAAs, in part independently from TIMP-3. Using an online database (www. [score:5]
Collectively, these results suggest that inhibition of miR-181b dramatically increases macrophage TIMP-3 expression and thus retards plaque progression and promotes a more stable phenotype. [score:5]
P [CT] refers to the probability of preferentially conserved targeting, demonstrating miR-181b preferentially targets ELN in both species. [score:5]
Taken together, these findings imply a dual beneficial effect of miR-181b inhibition during atherosclerosis and AAAs, namely increased macrophage TIMP-3 protein expression and heightened VSMC elastin production, which could eventually be exploited therapeutically. [score:5]
org), we identified that mature miR-181b can target both mouse and human elastin mRNA at the 3′-untranslated region (Figure 8H). [score:5]
Accordingly, inhibition of miR-181b in multiple mouse mo dels exerts antiatherosclerotic and antianeurysmal effects, predominantly through increasing macrophage TIMP-3 expression and vascular smooth muscle cell elastin levels. [score:5]
Moreover, confirmatory in situ hybridization indicated that the proportion of macrophages expressing miR-181b was significantly higher in unstable plaques compared with stable plaques (P<0.05; Figure 1H and Online Figure III) in direct contrast to TIMP-3 protein expression (Figure 1E). [score:5]
MiR-181b Regulates Macrophage TIMP-3 Expression and Associates With Cardiovascular Disease Progression in Humans. [score:5]
Furthermore, considering that TIMP-3 has been validated as a target of miR-181b, [13] our experiments conducted in Timp3–deficient mice strongly imply that the beneficial effects afforded by miR-181b inhibition are largely TIMP-3 dependent during atherosclerosis in Apoe [−/−] mice, although an additional protective effect is achieved through elevating elastin synthesis during formation of AAAs. [score:5]
Given the above, we hypothesized that miR-181b inhibition may restore macrophage TIMP-3 expression and prevent the progression of atherosclerosis. [score:5]
Inhibition of miR-181b protects against atherosclerosis and aortic aneurysm through increasing expression levels of macrophage TIMP-3 and vascular smooth muscle cell elastin. [score:5]
Furthermore, miR-181b expression in atherosclerotic plaques was inversely related to TIMP-3 protein expression because unstable plaques contained higher miR-181b levels (as assessed by quantitative polymerase chain reaction) than stable plaques (28-fold; P<0.05; Figure 1G). [score:5]
[10] We show here that GM-CSF sustains miR-181b expression during monocyte-to-macrophage differentiation, and TIMP-3 is therefore inhibited. [score:5]
MiR-181b Inhibition Does Not Affect Plaque Progression in the Absence of TIMP-3. MiR Inhibition Stabilizes AAAs in Angiotensin II–Infused Apoe [−/−] Mice. [score:4]
Consistent with the findings in atherosclerotic mice and in line with previous in vitro data showing impaired migration, [8] macrophage content was diminished in AAAs from miR-181b inhibitor -treated mice compared with scrambled control animals (Figure 4L and 4M), associated with marked suppression of macrophage proliferation rates and apoptotic frequencies (87% and 66% respectively; P<0.05; Figure 4L, 4N, and 4O). [score:4]
As expected, proteolytic activity was abrogated within plaques from miR-181b inhibitor -treated mice when compared with controls (by 70%; P<0.01; Figure 2B), as ascertained by in situ zymography, and comparable with the inhibitory effect achieved by addition of exogenous TIMP-3 (Figure 2B). [score:4]
To investigate whether miR-181b regulates tissue inhibitor of metalloproteinase-3 expression and affects atherosclerosis and aneurysms. [score:4]
Taken together, our results imply that miR-181b is a critical regulator of macrophage TIMP-3 expression during the progression of atherosclerosis and aortic aneurysms. [score:4]
Addition of Ang II to VSMCs in culture did not modulate miR-181b expression (Online Figure XIII), implying an indirect effect of Ang II, such as in response to hypertension. [score:4]
We also subjected 10-week high-fat–fed low-density lipoprotein receptor knockout mice (Ldlr [−/−]), which have preexisting atherosclerotic lesions within their brachiocephalic arteries (Online Figure IX) to 4-week treatment with the locked nucleic acid–modified miR-181b inhibitor or a scrambled miR to serve as control animals, while being maintained on a high-fat diet (n=6–8 per group, see Online Figure IV). [score:4]
Consistent with this, the lesion compositional changes translated to a decreased plaque vulnerability index [19] in mice receiving miR-181b inhibition compared with scrambled control animals (by 73%; P<0.01; Figure 2C and 2J). [score:4]
In situ zymography demonstrated that plaque proteolytic activity was significantly increased in Timp3 [−/−]/ Apoe [−/−] mice (4.4-fold; P<0.05) compared with controls and was unaffected by miR-181b inhibition (Figure 3I), implying that the effect of miR-181b inhibition on plaque elastin was, in part, independent of altered proteolysis. [score:4]
Hence, the TIMP-3–dependent reduction in proteolytic activity afforded through miR-181b inhibition translated into a retardation of plaque progression when compared with control animals, as observed by a reduction in lesion area (by 45%; P<0.05; Figure 2C and 2D). [score:4]
Further expansion in the average baseline maximal diameter before miR-181b inhibition was significantly decreased by miR-181b inhibition compared with scrambled miR control mice (Figure 6C). [score:4]
K, QPCR of TIMP-3 and miR-181b expression from control human NA aorta and AAA, n=10/group, ** P<0.01, 2-tailed Student t test. [score:3]
To validate our findings in human cardiovascular pathologies, we investigated the expression of miR-181b and its putative target TIMP-3 in human coronary atherosclerotic plaques and AAAs. [score:3]
Furthermore, elevated miR-181b expression occurred in human plaques histologically characterized as stable and correlated with decreased macrophage TIMP-3 expression. [score:3]
A, Kaplan–Meier curves of survival free from aneurysm rupture in control and miR-181b inhibitor -treated Ang II–infused hypercholesterolemic Timp3 [−/−] Apoe [−/−] mice, n=10 to 20/group. [score:3]
Similar favorable outcomes were observed in Ldlr [−/−] mice; aneurysm severity, aortic diameter, and associated vessel expansion were all reduced by miR-181b inhibitor treatment (Figure 6F– 6H and Online Figure XI). [score:3]
Second, macrophage TIMP-3 protein expression is reduced alongside increased miR-181b levels in both advanced human atherosclerotic plaques and AAAs. [score:3]
B, Representative images and quantification of proteolytic activity as assessed by in situ zymography of brachiocephalic plaques from scrambled control and miR-181b inhibitor -treated Apoe [−/−] mice, incubated with substrate alone or plus 10 nmol/L recombinant TIMP-3, # P<0.05 and represents significant difference from substrate alone; n=6 to 8 per group, ** P<0.01 and denotes significant difference from scrambled control mice, ANOVA, scale bar represents 50 μm and is applicable to all panels. [score:3]
We are aware that miR-181b has many additional predicted targets, which may be involved in the advantageous antiatherosclerotic and antianeurysm effects observed in vivo. [score:3]
Accordingly, the vulnerability index was unaffected in Timp3 [−/−]/ Apoe [−/−] mice by miR-181b inhibition (Figure 3G). [score:3]
These differences were independent of alterations in mRNA expression (Figure 1K), but consistent with the significant change in miR-181b levels we observed (Figure 1K). [score:3]
Therefore, mice with preexisting atherosclerotic lesions within their brachiocephalic arteries were treated with a locked nucleic acid–modified miR-181b inhibitor or a scrambled miR to serve as a control (n=6–8 per group; see Online Figure VI). [score:3]
I, 3′-UTR luciferase reporter activity of human ELN in HeLa cells treated with an miR-181b inhibitor or a scrambled control, n=6. [score:3]
By polarimetry, accumulation of red collagen fibers was greater in AAA tissues from miR-181b inhibitor -treated than control mice, indicating thicker and larger collagen fibrils [21] (Figure 4K). [score:3]
D, Western blot and (E) QPCR of TIMP3 in 7-day GM-CSF–differentiated macrophages after addition of an miR-181b inhibitor (miR-181bi) or a scrambled control (Ctrl), n=4/group, * P<0.05 and ** P<0.05, 2-tailed Student t test. [score:3]
We demonstrate here, for the first time, that miR-181b exacerbates these processes and consequently promotes inflammatory cardiovascular diseases. [score:3]
Inhibition of miR-181b favorably altered the composition of atherosclerotic plaques and AAAs consistent with improved stability. [score:3]
Considering that vessel wall vascular smooth muscle cells (VSMCs) are the predominant source of elastin production, the effect of miR-181b inhibition on this was assessed. [score:3]
A, miR-181b inhibition did not alter blood pressure levels. [score:3]
A, Quantification and associated representative images of aneurysm severity (increasing severity from stage I to stage IV as described by Raffort et al [12]) in scrambled control and miR-181b inhibitor -treated Apoe [−/−] mice with preexisting AAAs, using Fisher exact test, n=6 to 7/group. [score:3]
MiR-181b Inhibition Mitigates the Progression of Preexisting AAAs in Apoe [−/−] or Ldlr [−/−] MiceTo explore the therapeutic potential of miR-181b inhibition, we next investigated its ability to retard the progression of preexisting AAAs. [score:3]
As expected, miR-181b inhibition resulted in a significant increase in intraplaque TIMP-3–positive macrophages (by 90%; P<0.05; Figure 2A). [score:3]
TIMP-3 deficiency promotes atherosclerosis and aortic aneurysm formation and reduces the beneficial effects of miR-181b inhibition. [score:3]
Thus, miR-181b inhibition may have a protective role in other vascular pathologies, particularly aneurysms. [score:3]
G, Representative images of elastin van Gieson–stained histological cross-sections of AAAs from scrambled control and miR-181b inhibitor -treated Apoe [−/−] mice, demonstrating the differences in vessel diameter and elastin content (black), scale bar in ii represents 100 μm and is applicable to panels i, ii, and iv–x. [score:3]
H, Conserved miR-181b–binding sites of the 3′-untranslated region (3′-UTR) of human (hsa) and murine (mmu) elastin (ELN). [score:3]
Body weights were comparable between scrambled control (29.7±1.1 g) and miR-181b inhibitor -treated mice (30.2±1.3 g), indicating that locked nucleic acid–miR treatment was well tolerated, and no significant effect on lipid profiles was observed (Online Figure VII). [score:3]
Mean maximal diameter of descending thoracic aortas in miR-181b inhibitor -treated mice was significantly smaller than those of controls (31%, P<0.05; Figure 5A and 5B). [score:3]
G, QPCR of miR-181b expression from stable and unstable coronary atherosclerotic plaques, n=10/group, * P<0.05, 2-tailed Student t test. [score:3]
Furthermore, increased elastin content associated with miR-181b inhibition was accompanied by a more stable composition of atherosclerotic plaques and aneurysms, including greater collagen accumulation and enhanced smooth muscle cell to macrophage ratio. [score:3]
Collectively, miR-181b inhibition resulted in alterations in plaque composition that have been previously taken as markers of increased plaque stability. [score:3]
Our findings suggest that the management of miR-181b and its target genes provides therapeutic potential for limiting the progression of atherosclerosis and aneurysms and protecting them from rupture. [score:3]
Such inhibition of miR-181b could serve as a therapeutic approach in reversing the advancement of atherosclerosis and aortic aneurysms and avoiding the associated acute clinical syndromes. [score:3]
Nonetheless, our current findings demonstrate that restoration of TIMP-3 levels achieved through miR-181b inhibition retards the progression of atherosclerotic plaques and aneurysms at multiple vascular beds and in different mouse strains. [score:3]
MiR-181b Inhibition Regulates Matrix Composition at Other Aneurysmal Sites and Is Protective in an Additional Mouse Mo del. [score:3]
AAAs from miR-181b inhibitor -treated Apoe [−/−] mice were notably less dilated than those from controls (Figure 6A and 6B). [score:3]
Quantification of (C) vessel diameter, (D) collagen content, (E) elastin breaks, (F) elastin content, and (G) representative images of elastin van Gieson–stained AAAs from control and miR-181b inhibitor -treated Timp3 [−/−] Apoe [−/−] mice, n=6 to 7/group, scale bar in i represents 200 μm and is applicable to panels i and ii, scale bar in ii represents 100 μm and is applicable to panels iii and iv. [score:3]
Contrary to our expectations, inhibition of miR-181b significantly reduced death rates (from 55% to 25%, P<0.01; Figure 8A) after >14 days of Ang II infusion. [score:3]
These findings demonstrate that TIMP-3 is protective toward atherosclerosis and aneurysm formation and that targeting miR-181b may provide a novel strategy for limiting the progression of atherosclerotic plaques and aortic aneurysms. [score:3]
F, Quantification and associated representative images of aneurysm severity (increasing severity from stage I to stage IV as described by Raffort et al [12]) in scrambled control and miR-181b inhibitor -treated Ldlr [−/−] mice with preexisting AAAs, using Fisher exact test, n=6 to 7/group. [score:3]
H, Representative images and quantification of TIMP-3 protein expression by IHC and miR-181b by in situ hybridization (ISH) from stable and unstable coronary atherosclerotic plaques, n=10/group, * P<0.05, 2-tailed Student t test. [score:3]
In contrast to Apoe [−] [/−] mice (Figure 2D), miR-181b inhibition failed to retard plaque progression at either vascular site, in Timp3 [−] [/−]/ Apoe [−] [/−] mice (Figure 3A and 3B). [score:3]
To test whether miR-181b inhibition protects from AAA progression through TIMP-3, we used Timp3 [−/−]/ Apoe [−/−] mice. [score:3]
Moreover, miR-181b inhibitor significantly increased elastin content, as (Figure 6D and Online Figure VI) and reduced the frequency of elastin fragmentation (Figure 6E and Online Figure VI). [score:3]
Hence, miR-181b inhibition can also prevent the progression of preexisting AAAs, while increasing the elastin content of advanced AAAs. [score:3]
B, Quantification and associated representative images of aneurysm severity in control and miR-181b inhibitor -treated Timp3 [−/−] Apoe [−/−] mice, n=6 to 7/group. [score:3]
J, Quantification and associated representative images of aneurysm severity (increasing severity from stage I to stage IV as described by Raffort et al [12]) in scrambled control and miR-181b inhibitor -treated Ldlr [−/−] mice, using Fisher exact test, n=6 to 8/group, * P<0.05. [score:3]
MiR-181b Inhibition Mitigates the Progression of Preexisting AAAs in Apoe [−/−] or Ldlr [−/−] Mice. [score:2]
Elucidating novel pathogenetic factors, such as miR-181b, is therefore paramount for the development of efficient new therapies. [score:2]
C, Representative images and quantification of (D) plaque cross-sectional area in elastin van Gieson (EVG)–stained sections, (E) ratio of total lesional vascular smooth muscle cells (VSMC) and macrophages (Mac) assessed by immunohistochemistry, (F) lesional collagen content assessed by picrosirius red staining, (G) lesional necrotic core area, (H) lesional proliferation percentage determined by immunohistochemistry for proliferating cell nuclear antigen (PCNA), (I) lesional apoptosis percentage determined by immunohistochemistry for cleaved caspase-3 (CC3), (J) the plaque vulnerability index (necrotic core area+macrophage content/VSMC+collagen content), (K) lesional elastin content assessed by EVG staining, in brachiocephalic plaques from scrambled control and miR-181b inhibitor -treated Apoe [−/−] mice, n=6 to 8/group, * P<0.05 and ** P<0.01 compared with scrambled control mice, 2-tailed Student t test, scale bar in ii represents 100 μm and is applicable to panels i and ii, scale bar in iii represents 100 μm and is applicable to panels iii–viii, scale bar in ix represents 50 μm and is applicable to panels ix–xii. [score:2]
Moreover, and in line with our previous in vitro data, [8] intraplaque macrophage proliferation rates and apoptotic frequencies were reduced (88% and 68%, respectively; P<0.01; Figure 2C, 2H, and 2I) in brachiocephalic plaques from miR-181b inhibitor -treated mice compared with scrambled control animals. [score:2]
It has recently been reported that miR-181b can regulate nuclear factor-κB–mediated activation of endothelial cells and ensuing vascular inflammation. [score:2]
AAA severity was significantly reduced in miR-181b inhibitor -treated mice (Figure 5J) compared with scrambled control animals, which exhibited marked aneurysm formation. [score:2]
Quantification of (G) vessel diameter, (H) vessel expansion, (I) elastin content, and (J) elastin breaks in scrambled control and miR-181b inhibitor -treated Ldlr [−/−] mice with preexisting AAAs, n=6 to 7/group, * P<0.05 and ** P<0.01 compared with scrambled control mice, 2-tailed Student t test. [score:2]
Prominent breaks and fragmentation of the elastic lamellae, key features of AAAs, were abrogated in miR-181b inhibitor -treated compared with control animals (Figure 4I) in association with increased collagen accumulation (by 88%; Figure 4J and 4K). [score:2]
In the ascending thoracic aortas, miR-181b inhibitor -treated mice had decreased vessel expansion compared with controls (by 28%, P<0.05; Figure 5F and 5G), which was associated with increased elastin content and reduced elastin fragmentation (Figure 5H and 5I and Online Figure XI). [score:2]
K, Representative picrosirius red staining viewed under white light and linearly polarized light to show fibrillar collagen in AAAs of scrambled control and miR-181b inhibitor -treated Apoe [−/−] mice (scale bar in i represents 200 μm and is applicable to all panels), and associated qualitative analysis of new (green) and old (red) fibrillar collagen fiber content, n=6 to 8/group, * P<0.001 compared with scrambled control mice, Fisher exact test. [score:2]
Finally, miR-181b inhibition significantly augmented elastin content within plaques compared with scrambled control animals (2.6-fold; P<0.01; Figure 2C and 2K). [score:2]
I, Representative images and quantification of proteolytic activity as assessed by in situ zymography of brachiocephalic plaques from Timp3 [+/+] Apoe [−/−], Timp3 [−/−] Apoe [−/−], and miR-181b inhibitor -treated Timp3 [−/−] Apoe [−/−] mice, n=6 to 8/group, * P<0.05 compared with Timp3 [+/+] Apoe [−/−] control animals, ANOVA, scale bar represents 50 μm and is applicable to all panels. [score:2]
We demonstrate here that elastin stabilization is also achieved through a direct effect of miR-181b on elastin protein synthesis. [score:2]
Surprisingly, although plaque elastin content was, as expected, decreased in Timp3 [−/−]/ Apoe [−/−] mice (by 43%; P<0.05) compared with Timp3 [+/+]/ Apoe [−/−] control mice (Figure 3H), elastin content was restored to levels comparable with control animals, by miR-181b inhibitor treatment of Timp3 [−/−]/ Apoe [−/−] mice (Figure 3H). [score:2]
Quantification of (B) vessel diameter, (C) vessel expansion, (D) elastin content, and (E) elastin breaks in scrambled control and miR-181b inhibitor -treated Apoe [−/−] mice with preexisting AAAs, n=6 to 7/group, * P<0.05 and *** P=0.0007 compared with scrambled control mice, 2-tailed Student t test. [score:2]
L, Representative images and quantification of (M) macrophage content (N) proliferation percentage determined by immunohistochemistry for proliferating cell nuclear antigen (PCNA), and (O) apoptosis percentage determined by immunohistochemistry for cleaved caspase-3 (CC3), in AAAs from scrambled control and miR-181b inhibitor -treated Apoe [−/−] mice, n=6 to 8/group, * P<0.05 compared with scrambled control mice, 2-tailed Student t test, scale bar in i represents 100 μm and is applicable to all panels. [score:2]
A, Representative images and quantification of elastin van Gieson–stained histological cross-sections of descending thoracic aortas (TAs) from scrambled control and miR-181b inhibitor -treated Apoe [−/−] mice demonstrating the differences in (B) vessel diameter and (C) elastin content (black), n=6 to 8/group, * P<0.05 compared with scrambled control mice, 2-tailed Student t test scale bar in i represents 200 μm and is applicable to both panels. [score:2]
F, Representative images and quantification of elastin van Gieson–stained histological cross-sections of ascending TAs from scrambled control and miR-181b inhibitor -treated Apoe [−/−] mice, demonstrating the differences in (G) vessel diameter and (H) elastin content (black), n=6 to 8/group, * P<0.05 compared with scrambled control mice, 2-tailed Student t test scale bar in i represents 200 μm and is applicable to both panels. [score:2]
MiR-181b Inhibition Stabilizes Atherosclerotic Plaques in Hypercholesterolemic Apoe [−/] [−] Mice. [score:2]
Moreover, whereas it was observed that elastin fragmentation was more prevalent within brachiocephalic arteries from Timp3 [−/−]/ Apoe [−/−] mice (6.8-fold; P<0.0010) compared with Timp3 [+/+]/ Apoe [−/−] control mice (Figure 3J), miR-181b inhibition reduced the number of elastin breaks in Timp3 [−/−]/ Apoe [−/−] mice (by 66%; P<0.05), although still significantly greater in number than Timp3 [+/+]/ Apoe [−/−] control mice (Figure 3J). [score:2]
[22] We therefore investigated whether miR-181b inhibition prevents aneurysm formation within the ascending and descending thoracic aortae in our Ang II–infused, Apoe [−/−] mouse mo del. [score:1]
C, QPCR of miR-181b in human macrophages differentiated in the presence of M-CSF or GM-CSF, n=6/group, ** P<0.01, 2-tailed Student t test. [score:1]
Systemic delivery of anti-miR-181b in angiotensin II–infused Apoe [−/−] and Ldlr [−/−] mice attenuated aneurysm formation and progression within the ascending, thoracic, and abdominal aorta. [score:1]
To investigate whether the beneficial effects of miR-181b inhibition extended beyond Apoe [−/−] mice, we assessed AAA formation in Ang II–infused, high-fat–fed Ldlr [−/−] mice. [score:1]
To explore the therapeutic potential of miR-181b inhibition, we next investigated its ability to retard the progression of preexisting AAAs. [score:1]
Sun X Icli B Wara AK Belkin N He S Kobzik L Hunninghake GM Vera MP Blackwell TS Baron RM Feinberg MW MICU Registry MicroRNA-181b regulates NF-κB -mediated vascular inflammation. [score:1]
Quantification of (C) smooth muscle cell (SMC), (D) macrophage, (E) collagen content, (F) necrotic core area, (G) plaque vulnerability index (necrotic core area+macrophage content/vascular smooth muscle cell+collagen content), and (H) elastin content, in brachiocephalic plaques from Timp3 [+/+] Apoe [−/−], Timp3 [−/−] Apoe [−/−], and miR-181b inhibitor -treated Timp3 [−/−] Apoe [−/−] mice, n=6 to 8/group, * P<0.05, *** P=0.00013, and ### P=0.00938 compared with Timp3 [+/+] Apoe [−/−] control animals and # P<0.05 compared with Timp3 [−/−] Apoe [−/−] mice, ANOVA. [score:1]
J, Representative images and quantification of elastin breaks assessed by EVG staining of brachiocephalic plaques from Timp3 [+/+] Apoe [−/−], Timp3 [−/−] Apoe [−/−], and miR-181b inhibitor -treated Timp3 [−/−] Apoe [−/−] mice, n=6 to 8/group, *** P=0.0010 compared with Timp3 [+/+] Apoe [−/−] control animals and # P<0.05 compared with Timp3 [−/−] Apoe [−/−] mice, ANOVA. [score:1]
[59] All of this evidence supports the concept that GM-CSF plays a major part in atherosclerosis and AAAs, in part by sustaining miR-181b levels. [score:1]
[1 to 20 of 140 sentences]
2
[+] score: 357
Differentially expressed genes are classified as being predicted in preferential fashion by: Targetscan conserved predicted miR-181b target; Targetscan non-conserved predicted miR-181b target, with PCT (probability of conservation) scores <0.1; Targetscan non-conserved predicted miR-181b target, with PCT scores >0.1; not predicted as a miR-181b target by Targetscan, but predicted by the miRGen algorithm; predicted as containing E2F1 recognition signatures using the TRANSFAC algorithm. [score:19]
For a more stringent appraisal of genes and processes influenced by miR-181b expression, we examined genes both downregulated in response to miR-181b over -expression and upregulated by inhibition of endogenous miR-181b using the anti-miR inhibitor. [score:15]
Signal-to-noise ratio is shown to increase for both canonical and non-canonical function as stringency increases from genes modulated by either miR-181b over -expression or inhibition across at least two cell types; to genes modulated by either miR-181b over -expression or inhibition across all three cell types; to genes modulated by both miR-181b over -expression and inhibition across at least two cell types. [score:13]
There was also a significant difference between the mean FNR for miR-181b over -expression, inhibition, and bidirectional approaches (p=0.0067), with average FNRs for miRNA inhibition and bidirectional modulation (0.77) significantly lower than for miRNA over -expression (p<0.009). [score:11]
miRNA target predictions were downloaded from TargetScan Human Release 5.2, with predicted target genes for miR-181b and miR-107 categorised by cross-species conservation and seed-region composition before being correlated against the observed gene expression changes subsequent to miRNA modulation. [score:9]
A false negative indicates a gene differentially expressed with miRNA modulation, but not a predicted miR-181b target; and a false positive indicates a predicted miR-181b target that is not differentially expressed with miRNA modulation. [score:9]
Bidirectional modulation provided the greatest average accuracy across each cell type for Targetscan’s various prediction parameters of conservation and seed region (81.5%); significantly higher than miR-181b inhibition (77.6%, p<0.0001); which was in turn significantly higher than miR-181b over -expression (74.7%, p=0.0006). [score:8]
Interestingly, we observed very similar statistics for both types of interactions with regards to the relationship between gene expression and target prediction for the direction of miR-181b modulation; cell lineage; target conservation; and seed sequence (Figure 8B; Table 2). [score:8]
Firstly, the inhibition of miR-181b function revealed an enrichment of modulated genes in the MAPK signalling pathway for HEK-293, HeLa and SH-SY5Y cells, suggesting that endogenous miR-181b directly or indirectly regulates this critical cell-cycle signalling pathway in each of these cell types; pathways analysis revealed that only in HeLa cells did miR-181b appear to have the capacity to extend its regulation on this signalling pathway at higher miRNA concentrations. [score:7]
Further stringency of this prediction could also be attained by restricting the analysis to genes changed by both miR-181b over -expression and inhibition in two or more cell types, with miR-181b MREs alone accounting for 48% of differentially expressed genes, and MRE plus E2F1 motifs covering 84% (Figure 8C1). [score:7]
In view of these and other possible influences of miRNA on the transcriptome, we established a genome-wide survey of miRNA -associated target-transcript abundance to determine the genomic response to bidirectional modulation of miR-181b and miR-107, both of which have previously been reported to be upregulated in schizophrenia [27, 28]. [score:7]
To identify target genes common to each cell type, our analysis was expanded to genes modulated by either miR-181b over -expression or inhibition. [score:7]
In each cell condition, the predicted miR-181b target-response accuracy was significantly improved from 65.5% to 90.5% (p<0.0001) when excluding non-conserved targets from these analyses and considering only conserved targets (Figure 5A). [score:7]
In a similar fashion, the false -negative discovery rate (FNR) was calculated to determine the proportion of genes that were differentially expressed upon modulation of miRNA expression, despite not being predicted by Targetscan to be regulated by miR-181b (Figure 5B). [score:6]
The intersection of bidirectionally-modulated genes identifies genes modulated by both increased miR-181b expression (miR treatment) and miR-181b inhibition (anti-miR-181b treatment) in each cell type. [score:6]
We observed a large number of genes in the haematopoietic cell lineage pathway that were differentially expressed with increased intracellular miR-181b concentrations in HEK-293 cells, suggesting that genes within the haematopoietic pathway can be regulated by miR-181b when this miRNA is over-expressed in this cell line; as well as by endogenous miR-181b concentrations in both HEK-293 and SH-SY5Y cells. [score:6]
As expected we observed a significant (p<0.0001) miR-181b associated change in luciferase activity, however, the direction was contrary to expectation with a 52% increase in E2F1 reporter gene expression in response to miR-181b over -expression. [score:6]
Bidirectional 2+ indicates genes modulated by both miR-181b over -expression and inhibition across two or more cell mo dels. [score:6]
The variation observed for the 7mer-1A and 7mer-m8 seed regions between miR-181b and miR-107 supports the notion that determinants for target recognition exist outside of the seed region [62], while also highlighting the increased false -positive rate associated with non-conserved target predictions. [score:5]
Interestingly, we also observed elevation of differentially expressed genes with E2F1 motifs after miR-181b over -expression. [score:5]
Panel D contains charts of enriched KEGG pathways from genes modulated by either miR-181b over -expression or inhibition across at least two cell types. [score:5]
The values in this figure represent the average values across both miR-181b over -expression and inhibition in HEK-293, HeLa, and SH-SY5Y cell types. [score:5]
Panel A graphically represents the Transcription factor association of canonically modulated genes subsequent miR-181b over -expression or inhibition in HEK-293, HeLa, and SH-SY5Y cell mo dels. [score:5]
KEGG pathways analysis of predicted target genes for miR-181b revealed ten significantly enriched pathways: TGF-beta signalling (p=0.0023); prostate cancer (p=0.0037); neurodegenerative diseases (p=0.0061); melanogenesis (p=0.0062); long-term potentiation (p=0.0070); T-cell receptor signalling (p=0.0087); axon guidance (p=0.0106); MAPK signalling (p=0.0217); dorso-ventral axis formation (p=0.0236); and circadian rhythms (p=0.0410). [score:5]
Panel C shows the conservation status of predicted target genes modulated in response to altered miR-181b expression. [score:5]
Conservation scores for modulated predicted miR-181b targets, as predicted using Targetscan. [score:5]
This is exemplified by miR-181b which has been shown to be associated with schizophrenia [28]; muscle development [29]; haematopoiesis [30- 33]; and a variety of cancers, both as an oncogene [34- 43] and a tumour suppressor [44- 49]. [score:4]
In this respect, miR-181b has been shown to negatively regulate let-7 expression [69]. [score:4]
This revealed important regulatory roles for miR-181b in the regulation of the cell cycle, differentiation, and neurodevelopmental processes; and provided support for alternative RISC function, where miRNA-mRNA interactions lead to increases in transcript abundance in addition to the well-documented silencing -associated decrease. [score:4]
To investigate the power and limitations of target prediction we compared miR-181b associated genes in vitro with conserved and non-conserved targets predicted by Targetscan. [score:4]
Genes modulated by either miR-181b over -expression or inhibition were considered for the union of modulated genes across multiple cell types. [score:4]
In the latter of the two cell types, increased miR-181b levels also saw the modulation of the JAK-STAT signalling pathway, while endogenous miRNA expression was associated with regulating pathways involved in endometrial cancer, focal adhesion, and extracellular-matrix interaction. [score:4]
This suggests that miR-181b, predicted to bind to multiple MREs within the 3′-UTR of E2F1, is able to indirectly influence E2F1-regulated genes as a secondary consequence of E2F1’s own regulation by miR-181b. [score:4]
Biological processes enriched after bidirectional modulation of miR-181b expression. [score:4]
To further explore the role of miRNA in this context, we performed a genome-wide expression analysis to investigate the molecular consequences of bidirectional modulation of the disease -associated miRNAs miR-181b and miR-107 in multiple human cell lines. [score:4]
Either way, while these genes may not constitute direct targets of miR-181b, they are still significant to understanding its function in the context of specific biological environments. [score:4]
Positive regulation of myogenesis has also been supported by miR-181b suppression of HOXA11 and a HOXA11 reporter gene [29]. [score:4]
Cells were transfected with synthetic miR-181b, resulting in a substantial 288-, 165-, and 11.3-fold increase in miR-181b expression in HEK-293, HeLa, and SH-SY5Y cells respectively (Figure 2B). [score:3]
Overall, the gene expression analysis of canonical miR-107 function demonstrated great consistency with miR-181b in respect to prediction-response evaluation using a Targetscan framework (Figure 9B1). [score:3]
This demonstrates that miR-181b has the capacity to modulate E2F1 expression through it’s 3′-UTR, and suggests a mechanism to explain miR-181b associated changes in genes lacking a corresponding MRE. [score:3]
Responsiveness of the firefly luciferase reporter gene to increased miR-181b expression (miR-181b transfection) was analysed with respect to a pRL-TK renilla luciferase control. [score:3]
These results, in addition to the literature, indicate a key role for miR-181b in the fine-tuning of expression levels of numerous functionally related genes in specific signalling pathways. [score:3]
Figure 2 Biological processes affected by miR-181b over -expression in cell culture via miR-181b transfection. [score:3]
Predicted target genes for miR-181b were generated from the miRGen database and submitted for pathways analysis to DAVID. [score:3]
This revealed that a large proportion of target genes are not conserved and that many genes are modified by miRNA -associated secondary influence, exemplified by the relationship between miR-181b E2F1 transcription factor and genes with E2F1 motifs. [score:3]
Panel C, pie charts illustrating the distribution of miR-181b and E2F1 target genes predicted using different algorithms and parameters in multiple cell types. [score:3]
Panel B shows the increase in miR-181b expression levels in comparison to controls for HEK-293, HeLa and SH-SY5Y cell types. [score:3]
This supports the strong and repeated association of miR-181b and haematopoiesis previously reported in the literature, with targets including the murine Bcl-2, CD69 and the T-cell receptor [32], along with the chemokine [C-X-C motif] receptor 4 (CXCR4) [33]. [score:3]
Genes sensitive to both increased and decreased miRNA expression in multiple cell lines were scanned for potential miR-181b MREs using the miRanda shell script. [score:3]
Finally, a large proportion of miR-181b associated genes devoid of the corresponding miRNA recognition element, were enriched with binding motifs for the E2F1 transcription factor, which is encoded by a miR-181b target gene. [score:3]
Figure 3 Biological processes affected by inhibition of endogenous miR-181b in cell culture in response to anti-miR-181b transfection. [score:3]
Moreover, predicted miR-181b and E2F1 function for both canonical and non-canonical responses was also highly correlated (R [2]: 0.990, p<0.0001) in classifying the contribution to the gene expression profile across all conditions. [score:3]
Panel B shows the decrease in miR-181b expression levels in comparison to controls for HEK-293, HeLa and SH-SY5Y cell types. [score:3]
As with miR-181b, the only parameter not to show significant correlation between canonical and non-canonical miR-107 function is for Targetscan’s conserved parameter, in which the FPR and FNR were not significantly correlated, despite no significant difference between these features by t-test (FPR: p=0.7441; FNR: p=0.7222). [score:3]
Functional significance of miR-181b was inferred from pathways analysis of its predicted target genes using the DAVID bioinformatics functional annotation tool (Figure 1). [score:3]
While there is likely to be other miR-181b target genes with the potential to exert a downstream influence, these should be limited by the relatively short time frame of this experiment (24 hours). [score:3]
This approach revealed ten significantly enriched pathways (p<0.05), including TGF-beta signalling, neurodegenerative diseases, long-term potentiation, axon guidance, MAPK signalling, and dorso-ventral axis formation (see Additional file 1: Tables S2–S6 for all miR-181b enriched KEGG pathways analyses, p-values, and associated genes). [score:3]
The miR-181b predicted target genes were determined using multiple search algorithms in the miRGen database. [score:3]
Cells were transfected with a sequence-specific antisense inhibitor of miR-181b (anti-miR-181b) causing a decrease in the intracellular concentration of miR-181b in the order of 2.2-, 11.6-, and 1.4-fold in HEK-293 cells, HeLa cells, and SH-SY5Y cells respectively (Figure 3B). [score:3]
Figure 1 KEGG pathways analysis of predicted miR-181b target genes. [score:3]
Predicted miR-181b target genes and functional annotation. [score:3]
Biological processes affected by increased miR-181b expression in cell culture. [score:3]
Whole-genome expression analysis was subsequently performed to identify genes altered in the presence of increased intracellular miR-181b concentrations (Figure 2C). [score:3]
Despite the unexpected direction of this response, it nevertheless provides a means for this downstream influence observed in response to miR-181b modulation. [score:2]
A complex association of both positive and negative regulation of oncogenic processes was also suggested by the identification of a miR-181b MRE within the pro-apoptotic protein BIK [50], as well as a highly-conserved MRE in the tumour invasion factor MMP14 [51, 52]. [score:2]
Bidirectionally modulated genes are enriched with miR-181b and E2F1 binding sites. [score:2]
miR-181b functions as a complex regulator of cell cycle progression and differentiation. [score:2]
Similarly a conserved miR-181b MRE was also identified in MTMR1, previously identified as an important regulator of myogenesis through its association with muscular disorders such as myotubular myopathy and congenital myotonic dystrophy [53, 54], though its exact biological role is still unclear [54]. [score:2]
To investigate the possibility that miR-181b is regulating E2F1 in these cells, a reporter gene containing the E2F1 3′-UTR was co -transfected with miR-181b or its anti-miR inhibitor (Figure 7). [score:2]
The response of recombinant 3′-UTR motifs to miR-181b was normalised with respect to a mutant miR-181b control (miR-181b_mut, designed from the miR-181b backbone with mutations introduced at positions 3, 5, and 7; see Additional file 1: Table S1 for oligonucleotide sequences). [score:2]
Data was normalised against mutant miR-181b miRNA control transfection. [score:1]
Panel D shows the significantly enriched KEGG pathways for each cell type in response to decreased intracellular miR-181b levels. [score:1]
Putative miR-181b MREs containing synthetic sequences were cloned into Spe I and Hind III sites in the multiple cloning region downstream of the firefly luciferase gene in pMIR-REPORT (Ambion) backbone as described [27, 28, 71]. [score:1]
In addition to this influence, there is also a range of other mechanisms that may underlie the discrepancy between observed and predicted miR-181b response. [score:1]
To achieve this, 4μg pMIR-REPORT was incubated for two hours at 37°C with 2U each Spe I and Hind III, 10U of T4 DNA ligase, and 10μM of double-stranded DNA oligonucleotide of potential miR-181b recognition element. [score:1]
Collectively modulated genes with predicted miR-181b MREs, both conserved and non-conserved, still only accounted for a proportion (av. [score:1]
While a large proportion of miR-181b associated changes can be attributed to the presence of corresponding MREs or E2F1 binding motifs (52% in HEK-293 and HeLa cells; 70% in SH-SY5Y cells), this proportion increases significantly to over 80% in HEK-293 and HeLa cells when only bidirectionally modulated genes are considered (Additional file 4: Figure S3). [score:1]
They also multiply their influence through interaction with transcription factor genes exemplified by the observed miR-181b/E2F1 relationship. [score:1]
This revealed a consistent and highly significant enrichment of genes containing recognition signatures for several core transcription factors across each condition and cell type, including E2F transcription factor 1 (E2F1), the ETS domain transcription factors E74-like factor 1 (ELF1) and ETS-like gene 1 (ELK1), and the early growth response (KROX) transcription factor family; all of which possess miR-181b predicted binding sites. [score:1]
These interactions have significant implications for schizophrenia as miR-181b has been shown to be altered in the disorder [27, 28]. [score:1]
Panel D shows the significantly enriched KEGG pathways for each cell type in response to increased intracellular miR-181b levels. [score:1]
The E2F transcription factor 1 (E2F1) was particularly significant with multiple predicted miR-181b MREs and repeated enrichment of E2F1 transcription factor recognition signatures across multiple conditions (Additional file 3: Figure S2). [score:1]
Panel A shows the proportion of modulated genes that can be attributed to predicted miR-181b and E2F1 function across individual and multiple cell mo dels; whilst Panel B shows this for miR-107 predicted function. [score:1]
Further to this, we observed an enrichment of modulated genes involved in cytokine-cytokine receptor interaction by endogenous miR-181b levels in SH-SY5Y cells, and by increased miRNA concentrations in HEK-293 and HeLa cells. [score:1]
To characterise the change in mRNA transcript abundance in response to this reduction of endogenous miR-181b, we again used whole genome expression array analysis (Figure 3C). [score:1]
This identified 14 novel miR-181b MREs within 11 genes (p<0.05): BCL2-interacting killer (apoptosis-inducing) (BIK); cholinergic receptor, nicotinic, alpha 2 (neuronal) (CHRNA2); disrupted in schizophrenia 1 (DISC1); enkurin (ENKUR/c10orf63); fibrinogen alpha chain (FGA), G protein-coupled receptor 78 (GPR78); potassium large conductance calcium-activated channel, subfamily M, beta member 2 (KCNMB2); matrix metallopeptidase 14 (membrane-inserted) (MMP14); myotubularin related protein 1 (MTMR1); nuclear receptor subfamily 6, group A, member 1 (NR6A1); and solute carrier family 22 (organic anion transporter), member 7 (SLC22A7) (Figure 6; Table 1). [score:1]
This was further supported by the validation of miR-181b MREs within the 3′-UTRs of the schizophrenia susceptibility genes DISC1 [55- 57], ENKUR [58] and GPR78 [59], as well as the nicotinic acetylcholine receptor CHRNA2, and the potent binding site in KCNMB2, involved in controlling neuronal excitability by functioning as a subunit in large conductance voltage and calcium−activated potassium channels – also known as BK, MaxiK, or Slo channels [60, 61]. [score:1]
For example, alternative polyadenylation and splicing often produces tissue-specific 3′-UTR variants [63, 64], such that specific gene isoforms may contain or exclude MREs for miR-181b. [score:1]
Our analysis of this effect did not reveal enrichment of predicted let-7 MREs between genes demonstrating negative and positive miRNA-mRNA correlation for miR-181b. [score:1]
Panel B illustrates predicted binding sites for schizophrenia -associated miR-181b, miR-107, and miR-20a in the 3′-UTR of E2F1, as well as the AU-rich element in this 3′-UTR. [score:1]
Further evidence of this phenomenon in miR-107 datasets suggests this behaviour extends beyond let-7-miR-181b feedback. [score:1]
Biological processes affected by miR-181b depletion in cell culture. [score:1]
Importantly, we observed a consistent and significant enrichment of the neuroactive ligand-receptor interaction pathway across all three cell types treated with miR-181b, in addition to its enrichment in both HEK-293 and SH-SY5Y cells treated with anti-miR-181b. [score:1]
Significantly, many of these genes lacking predicted MREs for miR-181b contained binding motifs for the E2F1 transcription factor (av. [score:1]
[1 to 20 of 94 sentences]
3
[+] score: 308
These results strongly demonstrate that NOVA1 is a target gene of miR-181b-5p, which directly recognizes the 3′-UTR of the NOVA1 transcript to downregulate its expression. [score:9]
Our previous studies indicated that miR-181b-5p is downregulated in astrocytoma and that this reduced expression of miR-181b-5p is associated with a poor survival outcome, suggesting that miR-181b-5p may act as a tumor suppressor during astrocytoma development and/or progression [7]. [score:9]
In our study, miR-181b-5p directly targeted NOVA1 expression in astrocytoma cells, playing important roles in disease progression. [score:8]
As shown in Figure 5, ectopic expression of NOVA1 significantly prevented the suppression of proliferation (Figure 5A) and apoptosis (Figure 5B) induced by miR-181b-5p, indicating that NOVA1 was directly responsible for the biological effects induced by miR-181b-5p overexpression. [score:8]
As shown in Figure S1 in File S1, overexpression of miR-181b-5p significantly inhibited the proliferation (Figure S1A in File S1), migration (Figure S1B in File S1), invasion (Figure S1C in File S1) and promoted cellular apoptosis (Figure S1D in File S1) in U87 cells, while the inhibition of miR-181b-5p had opposite effects. [score:7]
A qRT-PCR analysis revealed that the inhibition of miR-181b-5p in U251 cells led to increased expression of endogenous NOVA1 mRNA compared with the control; conversely, the enhanced expression of miR-181b-5p decreased the expression of endogenous NOVA1 mRNA compared with the control (Figure 3C). [score:7]
Previous studies have reported that miR-181b-5p functions in gliomas to suppress growth by targeting the IGF-1R oncogene [8] and modulates glioma cell sensitivity to temozolomide by targeting MEK1 [9]. [score:7]
Recently, miR-181b-5p was found to inhibit glioma cell proliferation, migration, invasion and tumorigenesis by targeting IGF-1R [8] and to reduce chemoresistance to temozolomide in glioma cells by targeting MEK1 [9]. [score:7]
Similar to miR-181b-5p overexpression, we found that reduced expression of NOVA1 significantly inhibited cell proliferation, migration and invasion, similar to those induced by miR-181b-5p. [score:7]
As NOVA1 is the direct target gene of miR-181b-5p, we asked whether NOVA1 was upregulated in human samples. [score:7]
miR-106a-5p and miR-181b-5p are two of the most significantly downregulated miRNAs in astrocytomas, and their low expression levels are significantly associated with a poor survival outcome; this observation triggered our interest in investigating their function and their target genes during astrocytoma development. [score:7]
In our previous studies, we found that the reduced expression of miR-181b-5p was significantly associated with poor survival outcome, so we asked whether NOVA1 upregulation was correlated with patient survival. [score:6]
The oligonucleotide miR-181b-5p mimic (pre-miR-181b-5p), mimic negative control (pre-ncRNA), miR-181b-5p inhibitor (anti-miR-181b-5p) and inhibitor negative control (anti-ncRNA) were purchased from GenePharma (Shanghai, China). [score:5]
To determine whether reduced miR-181b-5p expression correlates with levels of NOVA1 expression in tumor tissues, Spearman's correlation analysis was carried out. [score:5]
miR-181b-5p overexpression inhibits cell proliferation, migration and invasion and induces apoptosis in vitro. [score:5]
These data support the notion that low miR-181b-5p expression is closely related to astrocytoma progression and that this miRNA may act as a tumor suppressor in astrocytoma. [score:5]
The overexpression of miR-181b-5p decreased the migration capacity of astrocytoma cells, whereas the inhibition of miR-181b-5p promoted migration (Figure 2C). [score:5]
All of the cells transfected with pre-miR-181b-5p exhibited reduced NOVA1 expression relative to the cells transfected with pre-ncRNA, whereas the cells transfected with anti-miR-181b-5p exhibited enhanced NOVA1 expression relative to the cells transfected with anti-ncRNA (Figure 3D). [score:5]
As shown in Figure 2E, the overexpression of miR-181b-5p induced by transfection with pre-miR-181b-5p resulted in a significant increase in apoptotic cells, whereas the inhibition of miR-181b-5p slightly reduced the number of apoptotic cells. [score:5]
The expression of NOVA1 in NAT samples were arbitrarily set at 1. (G) Spearman's correlation analysis was used to determine the correlation between the expression levels of NOVA1 and miR-181b-5p in human astrocytoma specimens. [score:5]
The ectopic expression of miR-181b-5p suppressed cell proliferation, migration and invasion and induced apoptosis in vitro. [score:5]
The overexpression of miR-181b-5p inhibits astrocytoma cell proliferation, migration and invasion and promotes apoptosis. [score:5]
As shown above, overexpression of miR-181b-5p inhibited proliferation, migration, and invasion of astrocytoma cells. [score:5]
Overexpression of NOVA1 reversed the inhibitory effects of miR-181b-5p. [score:5]
The overexpression of miR-181b-5p and corresponding reduced expression of NOVA1 decreased the oncogenic potential of cells, as evidenced by decreases in the proliferation rate and cell migration and increased apoptosis damage. [score:5]
To further elucidate whether the tumor suppressive effect of miR-181b-5p was mediated by repression of NOVA1 in astrocytoma cells, a NOVA1 expression vector which encoded the entire coding sequence without the 3′-UTR was transfected into U251 cancer cells. [score:5]
To fully understand the mechanisms of miR-181b-5p action in astrocytoma, we used three computational algorithms, miRanda, TargetScan and Pictar, to search for potential targets of miR-181b-5p and selected NOVA1 for further analysis. [score:5]
miR-181b-5p promotes cell proliferation, increases cell migration and invasion and inhibits apoptosis in prostate cancer [17] and gastric cancer by targeting TIMP3 [18]. [score:5]
Furthermore, the overexpression of miR-181b-5p induced by pre-miR-181b-5p transfection reduced the invasive ability of U251 cells, whereas the knockdown of miR-181b-5p significantly enhanced this ability (Figure 2D). [score:4]
These results showed that miR-181b-5p expression contributes to the regulation of astrocytoma cell proliferation and motility in vitro. [score:4]
Here, consistent with our previous studies, we found that miR-181b-5p was downregulated in human astrocytoma tissues. [score:4]
To determine whether the negative regulatory effects of miR-181b-5p on NOVA1 expression were mediated through binding to the presumed complementary sites at the 3′-UTR of NOVA1, we fused the entire NOVA1 3′-UTR into a downstream position of a firefly luciferase reporter plasmid. [score:4]
On the basis of a bioinformatic analysis, we further confirmed NOVA1 as a direct target of miR-181b-5p. [score:4]
NOVA1 is a direct target gene of miR-181b-5p. [score:4]
We also validated NOVA1 as a direct target of miR-181b-5p. [score:4]
Moreover, we show that NOVA1 is a direct target of miR-181b-5p. [score:4]
Overexpression Of Nova1 Reverses The Inhibitory Effects Of Mir-181b-5p. [score:4]
However, the potential role of miR-181b-5p as an oncogene or a tumor suppressor in cancer development remains controversial. [score:4]
miR-181b-5p is downregulated in astrocytoma tissue samples. [score:4]
As shown in Figure 3B, miR-181b-5p overexpression significantly decreased the luciferase reporter activity (normalized against β-gal activity) compared with the pre-ncRNA treatment, whereas the inhibition of miR-181b-5p significantly increased the reporter activity. [score:4]
However, whether miR-181b-5p is a tumor suppressive or oncogenic miRNA remains controversial, and the regulatory mechanism underlying miR-181b-5p -mediated function remains to be elucidated in different cancers. [score:4]
The mechanism by which miR-181b-5p decreases the oncogenic potential of cells is most likely through the inhibition of NOVA1. [score:3]
Nova1 Is A Direct Target Of Mir-181b-5p. [score:3]
To assess the expression of miR-181b-5p in astrocytomas, a qRT-PCR analysis was performed on 25 NAT samples and 90 astrocytoma tissue samples. [score:3]
In this study, we clearly demonstrate that miR-181b-5p functions as a tumor suppressor miRNA in astrocytoma. [score:3]
The aberrant expression of NOVA1 caused by miR-181b-5p may lead to the inappropriate alternative splicing of oncogenes, which may facilitate astrocytoma pathogenesis. [score:3]
The expression of miR-181b-5p was progressively decreased from the WHO grade I to the WHO grade IV astrocytomas. [score:3]
The miR-181b-5p expression was normalized to U6. [score:3]
Although much remains to be elucidated in terms of the role of miR-181b-5p in the pathogenesis of astrocytomas, miR-181b-5p represents a new potential therapeutic target for the treatment of this cancer. [score:3]
To further detect whether miR-181b-5p is associated with the migration ability of astrocytoma, we analyzed the effect of miR-181b-5p expression on the migratory and invasive behavior of U251 cells. [score:3]
Aberrant expression of miR-181b-5p in human astrocytomas. [score:3]
As shown in Figure 1B, the expression of miR-181b-5p in the high-grade astrocytomas was significantly lower than in the low-grade astrocytomas. [score:3]
miR-181b-5p overexpression inhibits cell proliferation, migration and invasion and induces apoptosis in vitro To investigate the biological functions of miR-181b-5p in astrocytoma cells, U251 cells were transfected with equal concentrations of pre-ncRNA, pre-miR-181b-5p, anti-ncRNA or anti-miR-181b-5p and analyzed for cell growth. [score:3]
The result showed that there was an inverse correlation between the expression levels of NOVA1 and miR-181b-5p (r = −0.60) in human astrocytomas (Figure 3G). [score:3]
The expression of miR-181b-5p was significantly increased by the introduction of pre-miR-181b-5p, whereas anti-miR-181b-5p abolished the miR-181b-5p levels in U251 cells (Figure 2A). [score:3]
To the best of our knowledge, this study is the first report showing the direct regulation of NOVA1 by miR-181b-5p. [score:3]
0109124.g001 Figure 1 The miR-181b-5p expression was normalized to U6. [score:3]
miR-181b-5p inhibitors or mimics were transfected into cancer cells, and the levels of NOVA1 mRNA and protein were monitored. [score:3]
For comparison, the expression levels of miR-181b-5p in pre-ncRNA- or anti-ncRNA transfected cells were arbitrarily set at 1. The results are presented as the mean ± SD of three independent experiments (*** p<0.001). [score:3]
The predicted interaction between miR-181b-5p and its target binding sites within the NOVA1 3′-UTR is illustrated in Figure 3A. [score:3]
In summary, our data indicate that miR-181b-5p is a tumor suppressor gene in astrocytomas. [score:3]
miR-181b-5p target prediction. [score:3]
For luciferase reporter assays, cells were cultured in 6-well plates, and each well was transfected with 2 µg of firefly luciferase reporter plasmid, 2 µg of β-galactosidase expression vector (Ambion) and equal amounts of pre-ncRNA, pre-miR-181b-5p, anti-ncRNA or anti-miR-181b-5p using Lipofectamine 2000 (Invitrogen). [score:2]
These results further confirm the negative regulation of NOVA1 by miR-181b-5p. [score:2]
The results showed that the expression of miR-181b-5p was consistently lower in the astrocytoma tissues compared with the NAT samples (Figure 1A). [score:2]
For comparison, the expression levels of miR-181b-5p in pre-miR-181b-5p- or anti-miR-181b-5p transfected cells were compared with their respective negative controls (* p<0.05, *** p<0.001). [score:2]
U251 cells were transfected with control vector + pre-ncRNA, control vector + pre-miR-181b-5p, NOVA1 vector + pre-ncRNA, and NOVA1 vector + pre-miR-181b-5p. [score:1]
U251 cells were transfected with equal concentrations of pre-ncRNA, pre-miR-181b-5p, anti-ncRNA and anti-miR-181b-5p. [score:1]
U87 cells were transfected with equal concentrations of pre-ncRNA, pre-miR-181b-5p, anti-ncRNA and anti-miR-181b-5p. [score:1]
The levels of mature miR-181b-5p were quantified using Taqman miRNA probes (Applied Biosystems), as previously reported [10]. [score:1]
miR-181b-5p also enhances drug resistance in breast cancer [19]– [20]. [score:1]
miR-181b-5p belongs to the miR-181 family, which includes miR-181a-5p, miR-181b-5p and miR-181c-5p. [score:1]
Firefly luciferase reporters containing either wt or mut NOVA1 3′-UTRs were co -transfected into U251 cells with pre-miR-181b-5p, anti-miR-181b-5p and their corresponding negative controls. [score:1]
The role of miR-181b-5p in cell proliferation, migration, invasion and apoptosis in vitro. [score:1]
Next, we used Annexin V and PI double-staining FACS analysis to investigate the effects of miR-181b-5p overexpression on astrocytoma cell apoptosis. [score:1]
pre-ncRNA, pre-miR-181b-5p, anti-ncRNA or anti-miR-181b-5p was transfected. [score:1]
In our previous study, we established a unique molecular diagnostic signature for astrocytomas that included miR-21-5p, miR-24-3p, miR-30c-5p, miR-106a-5p, miR-124-3p, miR-137 and miR-181b-5p [7]. [score:1]
Figure 3 (A) A schematic description of the hypothesized duplexes formed by interactions between the NOVA1 3′-UTR binding sites and miR-181b-5p. [score:1]
The relative cell survival rate of the pre-miR-181b-5p -transfected cells at 72 h was 66.5%, and the relative cell survival rate of the anti-miR-181b-5p -transfected cells at 72 h was 138.7%. [score:1]
The resulting plasmid was introduced into U251 cells combined with a transfection control plasmid (β-gal) as well as pre-ncRNA, pre-miR-181b-5p, anti-ncRNA or anti-miR-181b-5p. [score:1]
Figure S1, The role of miR-181b-5p in U87 cell proliferation, migration, invasion and apoptosis in vitro. [score:1]
Figure 2The role of miR-181b-5p in cell proliferation, migration, invasion and apoptosis in vitro. [score:1]
[1 to 20 of 82 sentences]
4
[+] score: 255
We hypothesized that, in conjunction with the host pro-inflammatory response during early infection, miR-181 expression might be up-regulated in HeV-infected mammals, but perhaps the virus co-opts this up-regulation to support infection and viral spread in the host. [score:9]
Expression of miR-181 is up-regulated in circulating biofluids derived from in vivo mo dels of henipavirus diseasePrevious studies have reported that members of the miR-181 family are involved in different aspects of immune regulation [43– 45]. [score:9]
Importantly, levels of EphA5 and EphA7, but not EphA4, are reduced by overexpression of both miR-181a and miR-181d, indicating that these class A Ephs are target genes for the miR-181 family, and that the pro-fusion phenotype of miR-181 are, at least in part, due to its downregulation of specific class A Ephs. [score:8]
Expression of miR-181 is up-regulated in circulating biofluids derived from in vivo mo dels of henipavirus disease. [score:8]
As each miRNA can act as a suppressor of many target genes, we hypothesized that miR-181 and miR-17~93 families promoted henipavirus infection by suppressing multiple anti-viral host genes. [score:7]
This led us to hypothesize that miR-181 supported fusion by down -regulating the expression of one or more novel cellular factor(s) that antagonizes expression and/or activity of the henipavirus entry receptors, ephrin-B2 or–B3. [score:6]
miR-181 targets EphA5, EphA7 and EphB4, but not EphA4, for downregulation. [score:6]
Thus, a potential mo del for the pro-viral mechanism of miR-181 posits that the miRNA down-regulates expression of Ephs, increasing the pool of unbound ephrin-B2 or ephrin-B3 for henipavirus G glycoproteins to attach and trigger entry/membrane fusion. [score:6]
Intriguingly, even though the 3’UTR of EphB4 transcripts does not contain any sequence that is complementary to the seed region of miR-181, EphB4 levels were downregulated by miR-181 expression. [score:6]
These data show that endogenous levels of the henipavirus fusion regulators EphA5, A7 and B4 can all be significantly suppressed by miR-181 expression. [score:6]
We opted to assess all Ephs with putative miR-181 target sites as predicted by TargetScan [39, 40], namely EphA4, A5 and A7 (S4 Table). [score:5]
Verified miR-181 and miR-17~93 target genes predominantly inhibit henipavirus infection. [score:5]
Select Eph receptors inhibit HeV infection and cell-cell-fusion and are miR-181 target genes. [score:5]
Cross-referencing of results from the siRNA screen of host genes associated with HeV infection suggests that miR-181 and miR-17~93 target multiple host genes which are anti-viral for HeV, and that the net outcome of cellular expression of miR-181 or miR-17~93 is likely a host microenvironment that is more conducive for henipavirus infection. [score:5]
Since miR-181 specifically promotes infection of henipaviruses but not other paramyxoviruses, it is quite likely miR-181 increases membrane fusion by directly targeting viral and/or host molecules unique to the henipavirus fusion machinery. [score:4]
In fact, miR-181 downregulated ephrin-B3 and and HeV F glycoprotein by about 30 to 40%. [score:4]
Collectively, these observations demonstrate in two different in vivo mo dels that members of the miR-181 family are up-regulated early in the host during HeV infection, implicating a biological role for miR-181 in host immunity as well as in henipavirus pathogenesis. [score:4]
Consistent with this, we observed that miR-181 is up-regulated in sera of ferrets and blood of horses as early as day 1 during a henipavirus infection. [score:4]
We also sought to determine whether miR-181 preferentially regulates the expression of host proteins localized in a particular subcellular compartment. [score:4]
The screens, in addition to subsequent validation work, demonstrate a key role for miR-181 family members in regulating henipavirus syncytia formation and infection, and suggest several host miRNAs, including miR-17~93, as potential candidates for novel therapeutic targets. [score:4]
The mo del of miR-181 -mediated immune pathogenesis has potential implications for risk factors associated with susceptibility to henipavirus disease, as well as for the strategic design and development of novel immunotherapy for henipavirus infections. [score:4]
In contrast, EphA4 levels were not impacted by miR-181d, and were only modestly (11%) affected by miR-181a, demonstrating some level of specificity in the regulation of Eph receptor expression by miR-181. [score:4]
Accordingly, human EphB4 does contain a putative miR-181 binding site in its ORF, providing an avenue for miR-181 regulation of its expression. [score:4]
In stark contrast to henipaviruses, miR-181 has been shown to be inhibit infection of porcine reproductive and respiratory syndrome virus [63]. [score:3]
Collectively, these data suggest that the net outcome of miR-181 or miR17~93 expression is a cellular microenvironment that is more conducive for henipavirus infection. [score:3]
Expression of entry receptors ephrin-B2/B3 and viral fusion glycoproteins are not appreciably enhanced by miR-181. [score:3]
qRT-PCR analysis of miR-181 expression. [score:3]
Given the substantial impact of miR-181 on cell-cell fusion (Fig 5B and 5C), it was intriguing that the miRNA did not considerably enhance expression levels of host and viral molecules known to be involved in entry and fusion. [score:3]
Pie charts show the relative proportions of pro- and anti-viral target genes for miR-181 (C) and for miR-17~93 (D), with the number of genes printed. [score:3]
To this end, the list of experimentally-validated miR-181 targets (n = 78 genes) was obtained from miRTarBase was subjected to annotation enrichment analysis using the DAVID web service. [score:3]
Experimentally validated target genes for miR-181 and miR-17 families (miRTarBase, and their corresponding impact on HeV infection). [score:3]
Following qRT-PCR, miR-181 expression was analysed using the ΔΔC [T] method and normalised to U6. [score:3]
Impact of members of Eph receptor family on HeV infection [14] and their putative miR-181 binding sites (TargetScan). [score:3]
Members of the miR-181 and miR-17~93 families strongly promoted Hendra virus infection and appear to suppress multiple antiviral host molecules. [score:3]
Viral RNA synthesis is augmented by miR-181 over -expression. [score:3]
Along similar lines, but in a chronic infection, serum miR-181b is positively correlated with hepatitis B virus (HBV) DNA levels in human patients, and with disease progression of chronic HBV infection [65]. [score:3]
S4 TableImpact of members of Eph receptor family on HeV infection [14] and their putative miR-181 binding sites (TargetScan). [score:3]
That said, algorithmic analysis by TargetScan [39, 40] of all human Ephs does not predict miR-181 binding sites in the 3’ UTR of the mRNAs of EphB3 or EphB4 (S4 Table). [score:3]
Collectively, our data supports a mo del where simultaneous inhibition of multiple anti-fusion Ephs from both receptor classes by miR-181 contributes to greatly enhanced membrane fusion and infection. [score:3]
Additionally, miR-181 expression in human kidney tissues were found to be associated with increased transcription of genes of inflammation pathways [47]. [score:3]
It is tempting to speculate that the host pro-inflammatory response (of which blood miR-181 is correlated with) promotes the early phase of virus spread in the host, thereby contributing to disease progression and pathogenesis [43, 44, 46]. [score:3]
Dual miRNA screens reveal miR-181 and miR-17~93 families as promoters of henipavirus infection that target multiple anti-viral genes. [score:3]
corroborate what was observed by visual inspection, indicating that miR-181 overexpression induced a drastic 9- to 10-fold increase in fusion events relative to control (Fig 5C). [score:3]
This supports the mo del that miR-181 enhances syncytia formation by targeting Ephs that naturally associate with the henipavirus entry receptors ephrin-B2 and B3. [score:3]
A subset of class A Eph receptors contain putative miR-181 target sites. [score:3]
This analysis demonstrated an enrichment of miR-181 target genes associated with the nucleoplasm (p = 4.6e-5), while proteins associated with plasma membrane localization were not significantly enriched (p = 0.7). [score:3]
For instance, the ratio of anti-viral to pro-viral hits for validated miR-181 targets was 2.2 to 1 (Fig 2C). [score:3]
Values represent the sum of all the Z-scores, and demonstrate the predominance of anti-viral genes among the miR-181 and miR-17 targets. [score:3]
To test this hypothesis, we firstly mined the miRTarbase database [27] to identify all experimentally-validated target genes for miR-181 and miR17~93 families. [score:3]
Expression levels of miR-181 in biofluids of animals infected with HeV are increased. [score:3]
Infection promotion is primarily mediated via the ability of miR-181 to repress Eph receptors that negatively regulate henipavirus glycoprotein -mediated cell-cell fusion. [score:2]
To address whether miR-181 promotes entry of henipaviruses, a cell-cell fusion assay was performed using 293T effector cells expressing HeV F and G-glycoproteins [14]. [score:2]
Thus, we next investigated if miR-181 overexpression would enhance expression of the virus entry receptors ephrin-B2 and -B3, as well as the viral fusion glycoproteins F and G. miR-181a agonists were included in this analysis, subsequent to the validation of their pro-fusion nature in infection and fusion assays (S2 Fig). [score:2]
These results indicate that, in addition to its role in regulating fusion, miR-181 might act via other anti-viral host mediators to induce a situation that is broadly supportive of henipavirus replication. [score:2]
Previous studies have reported that members of the miR-181 family are involved in different aspects of immune regulation [43– 45]. [score:2]
Considering that EphB4 is most antagonistic towards fusion (Fig 7C), it likely makes the most significant contribution to the pro-fusion phenotype of miR-181. [score:1]
Similar to results observed in ferret, transient yet significant increases in circulating miR-181 molecules were observed during the early stages of infection. [score:1]
However, and rather intriguingly, unlike miR-181 (Fig 4), members of the miR-17~93 family appear to also exhibit pro-viral effects on a paramyxovirus from a different subfamily than the henipaviruses. [score:1]
The seed sequence of the miRNAs in this family (AAAGUG) is distinct from that of miR-181. [score:1]
Considering the striking pro-fusogenic activity of miR-181, we wondered whether this effect is unique to the miR-181 family of miRNAs. [score:1]
Thus, miR-181 promotes henipavirus infection at, or prior to, the step of viral RNA synthesis. [score:1]
To assess whether the pro-viral effects of miR-181 are specific to HeV, the in vitro activity of miR-181d agonists were tested on a range of viruses from different subfamilies of the Paramyxoviridae family. [score:1]
Interestingly, this infection enhancement seems to be primarily mediated via the ability of miR-181 to significantly augment henipavirus glycoprotein -mediated cell-cell fusion, implicating miR-181 in the enhancement of henipavirus entry. [score:1]
We found that miR-181 did not affect infection by paramyxoviruses from other genera, indicating specificity in the henipavirus-miR181 virus-host interaction. [score:1]
Congruent with this notion, viral RNA synthesis in a single round of infection is elevated in cells transfected with miR-181 agonists. [score:1]
miR-181 impacts henipavirus infection but not paramyxoviruses from other genera. [score:1]
In addition to miR-181, most members of the miR-17~93 family were pro-viral (Fig 2B). [score:1]
In order to narrow down the possible mechanisms by which miR-181 promotes henipavirus infection, we next sought to delineate the part of the virus life cycle at which miR-181 promotes infection. [score:1]
All four members of the miR-181 family exhibited consistent pro-viral phenotypes in both the agonist and antagonist screens (Figs 1D and 2A). [score:1]
miR-181 significantly enhances HeV F- and G -mediated cell-cell fusion. [score:1]
This pro-fusion effect is specific to the miR-181 family, as transfection with agonists of another strongly pro-viral miRNA (miR-17), did not appreciably alter syncytia formation. [score:1]
Even though it was not predicted to contain any miR-181 binding sites, EphB4 was the most anti-viral hit of the class B receptors in the RNAi screen and was previously shown to compete with HeV G glycoprotein for ephrin-B2 binding [38], so it was incorporated into our study as well. [score:1]
The scale of the pro-viral impacts of miR-181 members is especially remarkable if we compare their effects to that of miR-146a (Fig 2A), which we previously validated as pro-viral for HeV [22]. [score:1]
Since henipavirus mediated cell-cell fusion is both a surrogate mo del for virus entry as well as a natural phenomenon during late stages of infection, it is likely that in addition to enhancing henipavirus entry, miR-181 also promotes more efficient cell-to-cell spread of this virus by merging the cytosols of neighbouring cells more rapidly. [score:1]
Both complementary screens converged on members of four miRNA families (miR-181, miR-17~93, miR-520h, miR-548d) that strongly promoted henipavirus infection. [score:1]
Even though the role of miR-181 in inflammation and NKT-cell maturation has been documented [23, 43– 46], little has been reported about its role in the infection of other viruses. [score:1]
All four members of the miR-181 family significantly promoted HeV infection (Fig 2A). [score:1]
These results indicate that the enhancement effects of miR-181 are specific to the henipavirus genus. [score:1]
miR-181 significantly enhances HeV RNA synthesis and F- and G -mediated cell-cell fusion. [score:1]
Initial in silico analysis revealed that EphA4, EphA5 and EphA7 possess putative miR-181 binding sites in the 3’ UTRs of their transcripts. [score:1]
Cells were transfected with miR-181 agonists, and then infected with a high MOI (5) of HeV. [score:1]
To evaluate whether these anti-fusion Ephs are suppression targets of miR-181, the mRNA levels of the Ephs in agonist -transfected cells were measured by qRT-PCR. [score:1]
Interestingly, miR-181 -transfected cells induced substantially more, and larger, syncytia. [score:1]
We first looked at whether viral RNA synthesis was induced by miR-181 during a single round of HeV infection. [score:1]
This provides a coherent mechanistic mo del for how miR-181 may expedite host entry and virus spread during infection. [score:1]
Screen results suggested that miR-181d is one of the most pro-viral members of the family (Fig 2A, S1 Table and S2 Table), hence miR-181d was chosen as a representative member of the miR-181 family in the majority of subsequent experiments. [score:1]
In sum, these results indicate that HeV-glycoprotein mediated cell-cell fusion is greatly stimulated by miR-181, but not by miR-17, suggesting that miR-181 specifically facilitates henipavirus infection by enhancing host entry and, quite possibly, by supporting cell-to-cell spread during late stages of infection via syncytia formation. [score:1]
We show that miR-181 promoted infection of both wild-type HeV and NiV infections. [score:1]
Since all four members of the miR-181 family were pro-viral hits using this approach, we focused our validation efforts on miR-181. [score:1]
miR-181 promotes Hendra virus infection of human cells. [score:1]
1005974.g002 Fig 2(A and B) from miRNA screens for all miR-181 (A) and miR-17~93 (B) family members, represented by robust Z-scores. [score:1]
This study implicates miR-181 and certain class A Eph receptors as critical modulators of henipavirus membrane fusion, and highlights how the natural innate immune response of the host can be exploited by a RNA virus to promote cell-to-cell spread. [score:1]
[1 to 20 of 92 sentences]
5
[+] score: 223
c-d CTDSPL expression was significantly inhibited after transfection with si-CTDSPL-1 and si-CTDSPL-2 in MUM2b and OCM1a cells, whereas pRB and E2F1 expression was significantly increased in MUM2b and OCM1a cells after transfection with si-CTDSPL-1 and si-CTDSPL-2. The gray level was analyzed by histogram seperately (*P < 0.05) miR-181 contributes to cell cycle progression via its target CTDSPL, which in turn increases expression of the cell cycle effector pRB/E2F1 in UM cellsOur work found that miR-181b is overexpressed in melanoma tissues and most UM cells and promotes cell cycle progression by repressing CTDSPL expression in UM cells. [score:15]
c-d CTDSPL expression was significantly inhibited after transfection with si-CTDSPL-1 and si-CTDSPL-2 in MUM2b and OCM1a cells, whereas pRB and E2F1 expression was significantly increased in MUM2b and OCM1a cells after transfection with si-CTDSPL-1 and si-CTDSPL-2. The gray level was analyzed by histogram seperately (*P < 0.05) Our work found that miR-181b is overexpressed in melanoma tissues and most UM cells and promotes cell cycle progression by repressing CTDSPL expression in UM cells. [score:11]
In contrast, the fraction of cells in G0/G1 phase was significantly increased by 12-15%, and the period of S-phases was significantly decreased 8-12% after the inhibitors of miR- 181 family members were transfected into OCM1a cells Bioinformatics and molecular biology assays confirmed CTDSPL as a target of miR-181 family membersTo identify the target gene(s) of miR-181, candidate genes were identified using the miRNA target prediction database TargetScan [13] (http://www. [score:10]
In contrast, the fraction of cells in G0/G1 phase was significantly increased by 12-15%, and the period of S-phases was significantly decreased 8-12% after the inhibitors of miR- 181 family members were transfected into OCM1a cells To identify the target gene(s) of miR-181, candidate genes were identified using the miRNA target prediction database TargetScan [13] (http://www. [score:9]
d and (f) Overexpression or knockdown of miR-181 expression inhibited or enhanced the Renilla luciferase activity, respectively. [score:8]
miR-181b over -expression inhibited CTDSPL expression, which in turn led to the phosphorylation of RB and an accumulation of the downstream cell cycle effector E2F1, promoting cell cycle progression in UM cells. [score:7]
e and (g) The Renilla luciferase activity was nearly unchanged after mimics and inhibitors of miR- 181 family members were transfected with the mutated 3’-UTR of CTDSPL miR-181b was extremely overexpressed in melanoma tissues and most UM cellsTo investigate the expression profile of miR-181 family members in UM, microarray technology was used to detect the expression of miR-181 family members in melanoma tissues. [score:7]
This finding suggests that miR-181b expression is specifically increased or unchanged, without downregulation, in all UM cells, but there is lack of universality in UM. [score:6]
In accordance with the microarray results, miR-181b was overexpressed in OCM1, SP6.5, VUP and 92-1 cells by nearly 50-fold and was up more than 1000-fold in 92-1 cells, while miR-181b was not upregulated in OCM1a or MUM2b cells (Fig. 3b). [score:6]
Western blot assays further indicated that mimics of miR-181 family members led to the reduced expression of CTDSPL, while inhibitors led to the increased expression of CTDSPL in MUM2b cells (Fig. 2b-c, P < 0.05). [score:6]
These data provide strong evidence that the miR-181 family members inhibit CTDSPL gene expression by directly binding to sites within its 3’-UTR. [score:6]
miR-181 contributes to cell cycle progression via its target CTDSPL, which in turn increases expression of the cell cycle effector pRB/E2F1 in UM cells. [score:5]
The decreased CTDSPL expression along with the increased E2F1 expression in MUM2b-over- miR-181b and OCM1a-over- miR- 181b cells supports our hypothesis. [score:5]
To examine whether miR-181 family members could directly regulate CTDSPL expression, 293 T cells were transfected with a luciferase reporter construct containing the putative wild-type and mutant 3’-UTR of CTDSPL binding sites, together with one of the following miRNAs: miR-181a, -181b, -181c, -181d, miR-NC, as-miR-181a, - 181b, - 181c, or - 181d. [score:5]
e and (g) The Renilla luciferase activity was nearly unchanged after mimics and inhibitors of miR- 181 family members were transfected with the mutated 3’-UTR of CTDSPL To investigate the expression profile of miR-181 family members in UM, microarray technology was used to detect the expression of miR-181 family members in melanoma tissues. [score:5]
Taken together, these results suggest that a high miR-181b expression may play an important role in UM through disrupting cell cycle control, promoting cell proliferation and consequently facilitating the development of UM via CTDSPL. [score:4]
miR-181 family members are highly conserved, and their upregulation promotes cell cycle progression. [score:4]
Thus, miR-181 induces cell cycle progression by repressing the downstream target CTDSPL, which in turn results in the phosphorylation of RB and an accumulation of the downstream cell cycle effector E2F1 Recently, miRNAs have emerged as important cellular regulators that mediate cellular proliferation and progression. [score:4]
Fig. 2CTDSPL is a direct target of miR-181 family members. [score:4]
Triplicate assays were performed for each sample, and the relative level of each miRNA was normalized to U6 (* P < 0.05) miR-181b overexpression promotes cell cycle progression through CTDSPL with the downstream release of E2F1 in MUM2b and OCM1a cellsTo explore the function of miR-181b, we constructed a high-level expression plasmid of human miR-181b. [score:4]
In summary, we have presented herein the novel finding that miR-181b contributes to cell cycle progression through depressing the expression of CTDSPL, which in turn activates the downstream effector E2F1 and promotes S-phase entry. [score:3]
The results demonstrated that mimics of miR-181 family members promoted cell cycle progression, while inhibitors of miR-181 family members led to cell cycle arrest (Fig. 1b-e). [score:3]
However, the molecular basis for this phenotype has not been elucidated, and the status of the downstream targets of miR-181b in UM has not been researched. [score:3]
miR-181b was extremely overexpressed in melanoma tissues and most UM cells. [score:3]
b The qRT-PCR results showed significantly higher expression of miR-181b of nearly 500-fold in MUM2b-over- miR- 181b and OCM1a-over- miR- 181b cells. [score:3]
There are five predicted target sites in the 3’-UTR of CTDSPL sequence for miR-181 family members. [score:3]
Furthermore, miR-181b was found to be extremely overexpressed in most UM cells. [score:3]
Overexpressing miR-181b plasmid construction, lentivirus package, cloning and stable transfection in UM cells. [score:3]
MiR-181 family members were found to be highly homologous across different species and their upregulation significantly induces UM cell cycle progression. [score:3]
Of the family members, miR-181b was significantly overexpressed in UM tissues and most UM cells. [score:3]
miR-181 overexpression in UM cells induces progression through the G1/S transition and promotes S-phase entry. [score:3]
miR-181 family members were predicted to target CTDSPL, which had previously been denoted as RBSP3 (RB1 serine phosphatase from human chromosome 3), a key downstream mediator of cell cycle progression, and has been reported to participate in acute myeloid leukemia pathogenesis [6]. [score:3]
Microarray assay and Bioinformatics analysis were used to find the potential target of miR-181b, and dual-luciferase reporter assays further identified the target gene. [score:3]
To determine the common target region of the miR-181 family in CTDSPL, a segment of wild-type and mutated 3’-UTR of the human CTDSPL cDNA was constructed. [score:3]
miR-181b overexpression promotes cell cycle progression through CTDSPL with the downstream release of E2F1 in MUM2b and OCM1a cells. [score:3]
miR-181 family members were found to be highly homologous and have the same target, CTDSPL. [score:3]
The viral supernatants were concentrated and used to obtain stably transfected miR-181b -overexpressing UM cells. [score:3]
However, the expression and function of the miR-181 family members in the pathogenesis of UM had not been established. [score:3]
Fig. 6 miR-181 targets CTDSPL, which modulates the cell cycle effector E2F1. [score:3]
These findings constitute a comprehensive foundation for future research on the important role miR-181 in the developmental pathology of UM. [score:2]
Compared with the control group, the cell cycle was at a later stage in miR-181b -overexpressing MUM2b and OCM1a cells. [score:2]
These results highlight that miR-181 family members, especially miR-181b, may be useful in the development of miRNA -based therapies and may serve as novel diagnostic and therapeutic candidate for UM. [score:2]
These findings raised the possibility that miR-181b might have an important role in UM development or pathogenesis. [score:2]
miR-181 family members are highly conserved, and their upregulation promotes cell cycle progressionTo explore the relationship among miR-181 family members, their sequence homology was investigated. [score:2]
Bioinformatics and molecular biology assays confirmed CTDSPL as a target of miR-181 family members. [score:2]
Bioinformatics and dual luciferase reporter assay confirmed CTDSPL as a target of miR-181b. [score:2]
Triplicate assays were performed for each sample, and the relative level of each miRNA was normalized to U6 (* P < 0.05) To explore the function of miR-181b, we constructed a high-level expression plasmid of human miR-181b. [score:2]
The expression level of miR-181 family in human uveal melanoma cell lines was measured via real-time PCR (RT-PCR). [score:1]
miR-181a and miR-181b are transcribed from two separated gene loci (miR-181a-1/miR-181b-1 and miR-181a-2/miR-181b-2), while miR-181c and miR-181d are transcribed from another locus [6]. [score:1]
miR-181 Uveal melanoma CTDSPL E2F1 Cell cycle Recently, miRNAs were found to play critical roles in many different cellular processes, especially in tumor progression. [score:1]
Thus, miR-181 induces cell cycle progression by repressing the downstream target CTDSPL, which in turn results in the phosphorylation of RB and an accumulation of the downstream cell cycle effector E2F1 To explore the relationship among miR-181 family members, their sequence homology was investigated. [score:1]
Next, miR-181 family members were detected in various types of UM cells, including OCM1, SP6.5, VUP, OCM1a, MUM2b and 92-1 cells. [score:1]
MiR-181 family members are key negative regulators of CTDSPL -mediated cell cycle progression. [score:1]
Evolutionary conservation analysis of the miR-181 family members indicated that the sequences of miR-181a, -181b, -181c, and -181d are partly conserved in Homo sapiens, Mus musculus, Rattus norvegicus, Bos taurus and Pan troglodytes (Fig.   1a). [score:1]
The hollow white rectangle indicates the five different gene loci of the miR-181 family members. [score:1]
Schematic representation of the pathway modulated by miR-181 in UM cells progressing through the cell cycle. [score:1]
Obvious green fluorescence was observed in MUM2b-over-miR-181b and OCM1a-over-miR-181b cells, but not in the control groups (original magnification 100X). [score:1]
To investigate the potential roles of miR-181 family members, miR-181 family mimics (miR-181a, -181b, -181c, and -181d) or inhibitors (as- miR-181a, -181b, -181c, and -181d) were separately transfected into MUM2b and OCM1a cells. [score:1]
MUM2b (3 × 10 [5]) or OCM1a (5 × 10 [5]) cells were cultured overnight in 6-well plates and transfected with 200 nM miR-NC, miR-181 family mimics, or as- miR-181 family members (GenePharma Co. [score:1]
The predicted sequences to which miR-181 binds in the 3’-UTR of CTDSPL are conserved in humans (Fig.   2a). [score:1]
Fig. 1The conservation and cell cycle analysis of miR-181 family members. [score:1]
The miR-181 family contains four miRNAs (miR-181a/b/c/d). [score:1]
293 T cells were cultured in DMEM supplemented with 10% FBS and maintained at 37 °C at a concentration of 6 × 10 [6] cells/ml and transfected using Lipofectamine 2000 reagent with 3 μg PL-shRNA-HSA-MIR-181b-5p, 3 μg pMD2. [score:1]
We thus hypothesized that miR-181b might contribute to UM pathogenesis via the CTDSPL–pRB–E2F1 pathway. [score:1]
miR-181a, - 181b, -181c and -181d are miR-181 members of the family, which has been rarely studied, especially uveal melanoma. [score:1]
However, the homology among the miR-181 family members and the contribution of miR-181a, -181b, -181c and -181d in UM have not yet been clarified. [score:1]
[1 to 20 of 66 sentences]
6
[+] score: 167
Finally, miR-181b has a pathogenic role in CLL: it is down-regulated in human CLL [39, 40] and its down-regulation has been associated with disease progression [38, 52]. [score:9]
The down-regulation of non-phosphorylated Akt protein was induced by miR-181b, but not anti-TCL1 siRNA, suggesting that either a direct or an indirect targeting by miR-181b had occurred. [score:8]
Here, we explored how the enforced expression of miR-181b, which is down-regulated in human CLL [39, 40] and has been associated with disease progression [38, 52], could affect the viability of leukemic cells developing in the Eμ-TCL1 mo del. [score:8]
Overall, the pathways affected by miR-181b are highly relevant for CLL pathogenesis, and the simultaneous inhibition of Akt and MAPK pathways, together with the repression of anti-apoptotic proteins such as TCL1, Bcl2 and Mcl1, appears to represent a wide and highly effective panel of targets for achieving a strong therapeutic effect, as shown by the fact that several of these pathways are targeted by some of the newly available drugs against CLL [71]. [score:7]
However, the simple down-regulation of TCL1, achieved through the use of anti-TCL1 siRNA, did not achieve the level of apoptosis induced by miR-181b in EHEB cells and mouse leukemic cells derived from the TCL1-tg mouse, indicating the existence of relevant targets other than TCL1 that are important in mediating biological effects. [score:6]
Our results showed that miR-181b could down-regulate TCL1 in malignant B-cell lines with high expression of endogenous TCL1. [score:6]
In addition, because of the known role of Tcl1 in Akt activation [55], miR-181b and anti-TCL1 siRNA were both likely responsible for the down-regulation of p-Akt, which was in turn responsible for the reduction of p-Bad. [score:4]
Having identified miR-181b as the most consistent regulator of TCL1 expression among those tested, we assessed its effects on cell viability. [score:4]
We confirmed this hypothesis by showing the ability of miR-181b to down-regulate TCL1 protein similarly to anti-TCL1 siRNA in TCL1-tg leukemic splenocytes (Figure 1D). [score:4]
As shown earlier, miR-181b could efficiently down-regulate TCL1 protein similarly to anti-TCL1 siRNA. [score:4]
This finding suggested that the biological effects of miR-181b were mediated by mechanisms other than, or in addition to, TCL1 down-regulation. [score:4]
miR-181b down-regulates TCL1 and reduces viability in human and mouse malignant B cells. [score:4]
Indeed, miR-181b shares the down-regulation of TCL1 with anti-TCL1 siRNA, but the effects on MCL1, BCL2, Akt and p-Erk were mainly or only induced by miR-181b. [score:4]
miR-181b induced a 60-70% reduction in Akt and phospho-Akt levels; conversely, anti-TCL1-siRNA did not affect Akt levels and we detected only a slight p-Akt reduction, which was likely due to the down-regulation of TCL1, a well-known activator of Akt [55]. [score:4]
B. showing the TCL1 down-regulation following miR-181b transfection (in RAJI cells, the shown lanes were from the same blot, but not originally next to each other). [score:4]
miR-181 and miR-29 could down-regulate TCL1, Mcl1, Bcl2 and Bcl2L11 [46- 48]. [score:4]
ERK1/2 was not directly targeted by miR-181b, as shown by the unaffected level of non-phosphorylated ERK, but the cross-talk between Ras/MEK/ERK and PI3K/AKT pathways, reported in many tumors [68- 70], suggested that the down-modulation of Akt could also influence Erk phosphorylation. [score:4]
Similarly to CLL patients [46], an inverse correlation between miR-181b expression and TCL1 protein levels was observed in TCL1-tg leukemic splenocytes (Supplementary Figure S4C), suggesting the existence of miR-181b regulation of TCL1 protein in these cells as well. [score:4]
It was previously demonstrated that miR-29b and miR-181b could down-modulate TCL1 protein expression in HEK293 cells [46], but the same results have not been yet reported in B cells. [score:3]
Thus, in vitro results in both mouse and human cells showed that enforced miR-181b expression exerts a broad range of actions, affecting proliferative, survival and apoptotic factors, and indicated the appropriateness of the TCL1-tg mouse mo del for testing miR-181b as a therapeutic agent against mouse leukemic cells in vivo. [score:3]
The results of in vivo experiments did not attain leukemia regression, but significantly slowed the disease, thus demonstrating an in vivo anti-leukemic activity of miR-181b that was clearly detectable after 3 weeks of treatment. [score:3]
The use of miR-181b against leukemia that develops in the Eμ-TCL1 mouse mo del may present a potential drawback, as it may be argued that the anti-leukemic effect of miR-181b is effective only against the leukemic cells of this mo del because they are driven by TCL1, which is a miR-181b target. [score:3]
Viability and apoptotic effects following mir-181b enforced expression in human RAJI and EHEB cells and in mouse TCL1-tg leukemic splenocytes. [score:3]
In the first case, after miR-181b restoration, molecular analyses revealed a broad pattern of inhibition on important pathways involved in CLL. [score:3]
We next analyzed the expression of miR-181b and TCL1 protein levels in cells isolated from the spleen of individual 12- to 16-months old TCL1-tg mice with overt leukemia (Supplementary Figure S4A-B). [score:3]
From our analyses, miR-181b appeared to be the strongest TCL1 inhibitor among members of the miR-181 or miR-29 families. [score:3]
Mean values of six independent experiments were expressed as the ratio of miR-181b (black) versus control transfected cells and compared with those obtained by using anti-TCL1 siRNA (gray) (* P < 0.05 ** P < 0.01). [score:2]
In the second case, improved efficiency and specificity in the delivery approach might enhance miR-181b anti-leukemic activity. [score:1]
Figure 1 A. RAJI (black bars) and EHEB (gray bars) cells were transfected with miR-181b. [score:1]
In addition, miR-181b was similarly effective in mice transplanted with leukemic cells with either high or low Tcl1 levels. [score:1]
Here, we found that PEI significantly improves the delivery of miR-181b to the spleen in comparison with mimic alone, but margins of progress may still exist. [score:1]
We quantified protein levels by Western blotting in mouse leukemic splenocytes transfected with miR-181b or anti-TCL1 siRNA (Figure 2A). [score:1]
Akt and MAPK pathways were also analyzed after miR-181b or anti-TCL1 siRNA transfection. [score:1]
Conversely, Mcl-1 and Bcl2, two anti-apoptotic factors, were both down-modulated by miR-181b (about 70% and 50%, respectively), whereas anti-TCL1 siRNA induced only a slight reduction in MCL1 (about 20%) and had no effect on BCL2. [score:1]
Moreover, miR-181b was able to modulate the MAPK pathway through a marked down-modulation of phosphorylated active ERK1/2, a key factor in promoting proliferation signals through the MAPK pathway, which contributes to leukemia and is involved in drug resistance [65- 67]. [score:1]
D. TCL1 Western blot analysis of splenocytes after 72 h of transfection with anti-TCL1 siRNA or miR-181b or control (ctrl). [score:1]
Thus, compared with anti-TCL1-siRNA, miR-181b has a wider capacity to regulate proteins implicated in cell survival, which could explain the major effects of the miRNA on cell apoptosis and viability in TCL1-tg mouse leukemic cells. [score:1]
The densitometric ratio miR-181b/ctrl is shown at right. [score:1]
A. Immunoblotting analysis of Mcl1, Bcl2, phospho-Akt (p-Akt), Akt, phospho-ERK1/2 (p-ERK1/2), ERK1/2, IkBα, and PARP (cleaved form, cPARP) in leukemic splenocytes after transfection with miR-181b or anti-TCL1 siRNA or negative control (ctrl). [score:1]
A. RAJI (black bars) and EHEB (gray bars) cells were transfected with miR-181b. [score:1]
In RAJI cells, miR-181b induced a 1.5- and 1.6-fold increase in early and late apoptosis, respectively. [score:1]
We also found a marked reduction of phospho-ERK (65%), despite there being an increase in ERK protein in miR-181b transfected cells. [score:1]
miR-181b slows leukemia in the CLL mouse mo del. [score:1]
Hence, these arguments make it conceivable that the therapeutic effects observed following the restoration of miR-181b represent a general mechanism that is not limited to the leukemic cells of the Eμ-TCL1 mo del. [score:1]
At this stage, mice were randomized into three groups (average LE in each group = 0.1): 9 mice were treated with miR-181b, 9 mice were treated with scrambled negative control and 15 mice were left untreated. [score:1]
A reduction of normal B population is notable in peripheral blood in the presence of high LE, which was due to the replacement of normal with malignant cells [30], rather than to detection failure or side-effects related to miR-181b treatment (Supplementary Figure S6). [score:1]
miR-181b modulates key factors involved in CLL. [score:1]
Prior to administration, miR-181b or negative control mimics (Axolabs, Germany) were assembled in a complex with in vivo jetPEI (Polyplus-Transfection SA, France), using a nitrogen-to-phosphate ratio of 8, as recommended by the manufacturer. [score:1]
These findings, in line with other studies in which synergistic activity of miR-181b with fludarabine was observed in human primary CLL cells [63], add novel additional evidence for a potential role of miR-181b as a therapeutic agent in CLL. [score:1]
The images show clear differences between miR-181b -treated mice and controls. [score:1]
miR-181b modulates several pathways involved in CLL. [score:1]
Specificity of miR-181b activity was further confirmed by anti-miR-181b, which induced an increment in the TCL1 protein level (Supplementary Figure S2). [score:1]
In accordance with preliminary analyses (Supplementary Figure S5), mice were treated with 80 μg of miR-181b twice a week for three consecutive weeks. [score:1]
B. Representative plots of pre-treatment leukemia onset and post-treatment untreated mice, negative control (ctrl) or miR-181b -treated mice. [score:1]
The densitometric ratio between miR181b (black bars) or anti-TCL1 siRNA (gray bars) and the respective control (dashed line) is shown at right. [score:1]
The differences in delta LE values between miR-181b -treated and untreated mice or between miR-181b -treated and negative control -treated mice were both statistically significant (P = 0.005 and P = 0.04, respectively), whereas the differences between negative control -treated and untreated mice were not significant (P = 0.30). [score:1]
Notably, however, miR-181b reduced cell viability and increased apoptosis to a much higher extent than did anti-TCL1 siRNA (Figure 1C). [score:1]
B. Kaplan-Meier survival curves for the three groups, miR-181b -treated (solid line), negative control (neg ctrl) -treated (dashed line) or untreated mice (dotted line) were also assessed. [score:1]
miR-181b reduced the viability of mouse malignant cells to 50% of that of controls (P < 0.01) and resulted in a 1.5-fold increase in apoptosis (P < 0.05). [score:1]
The disparity in delta LE values between miR-181b -treated mice and negative control -treated or untreated animals is statistically significant (* P < 0.01; ** P < 0.05). [score:1]
Figure 2 A. Immunoblotting analysis of Mcl1, Bcl2, phospho-Akt (p-Akt), Akt, phospho-ERK1/2 (p-ERK1/2), ERK1/2, IkBα, and PARP (cleaved form, cPARP) in leukemic splenocytes after transfection with miR-181b or anti-TCL1 siRNA or negative control (ctrl). [score:1]
Following transfection of miRNA mimics of the miR-181 and miR-29 families, we assessed the TCL1 protein level. [score:1]
The miR-181b group shows significantly better survival (median survival 117 days) than the negative control group (median survival 91 days; P = 0.037) and the untreated group (median survival 92 days; P = 0.004). [score:1]
A clear reduction of the leukemic cell fraction was detectable in the samples derived from mice treated with miR-181b mimics (representative plots are shown in Figure 3B). [score:1]
The i. p. injections were administered twice a week for 3 weeks, using 80 μg of miR-181b each. [score:1]
Moreover, in EHEB cells, an Epstein-Barr virus-immortalized cell line established from a CLL patient [54], miR-181b induced a pronounced reduction of TCL1 protein (> 80%) accompanied by a significant increase in apoptosis (2.5- and 1.8-fold increase in early and late apoptosis, respectively) and a reduction in the proportion of live cells. [score:1]
Notably, response to miR-181b treatment was comparable in leukemias derived from the two donors (F3 and F15), despite the different Tcl1 and miR-181b endogenous levels (Supplementary Figure S4A-B). [score:1]
As illustrated in Figure 4A, the median delta LE was 0.14 after miR-181b treatment, whereas it was 0.70 in the control group and 0.75 in the untreated mice. [score:1]
The activation of apoptosis was confirmed by analysis of Poly (ADP-ribose) polymerase (PARP): a 70% reduction of the intact form and the appearance of the 85-kD fragment of cleaved PARP were seen only in the miR-181b transfected cells. [score:1]
These data indicate that miR-181b is efficient in reducing leukemic cell expansion, resulting in prolonged survival. [score:1]
As mentioned earlier, multiple survival pathways were affected by miR-181b, but not by anti-TCL1 siRNA, which may explain the different actions on apoptosis and viability. [score:1]
Administration of miR-181b to TCL1-tg mice induces delay in leukemic expansion (LE) and increases survival. [score:1]
After averaging all data, miR-181b emerged as being the most consistent in reducing TCL1 protein levels (P < 0.0005) (Supplementary Figure S1C). [score:1]
This was not the case: miR-181b induced stronger apoptosis than did anti-TCL1 siRNA. [score:1]
Survival in the miR-181b treated group was significantly increased for both untreated (P = 0.004) and negative control -treated (P = 0.037) groups. [score:1]
At least two explanations can be suggested for the lack of leukemia regression induced by miR-181b as a single agent: (i) The miRNA could not induce death of leukemic cells because it was incompletely effective; and (ii) the approach was incomplete and a number of leukemic cells escaped delivery. [score:1]
[1 to 20 of 76 sentences]
7
[+] score: 143
miR-181 downregulation enhanced by ~ 60% ALX/FPR2 protein expression in CFBE41o-cells (Fig.   2D), although it did not change ALX/FPR2 mRNA expression (results not shown). [score:8]
Inhibition of miR-181b upregulates and LXA [4] -induced responses in CF- MΦsTo obtain further evidence of a “cause and effect” relationship between miR-181b and ALX/FPR2, we transfected CF-MΦs with a miR-181b inhibitor. [score:8]
When miR-181b expression was downregulated, the effect of LXA [4] was enhanced by ~ 25% (Fig.   2E). [score:6]
On the other hand, we recently uncovered epigenetic regulatory mechanisms of, namely chromatin post-translational modifications [27] and mir-181b expression [26]. [score:6]
Inhibition of miR-181b upregulates and LXA [4] -induced responses in CF- MΦs. [score:6]
These results indicate that CFTR controls miR-181b expression, which in turn downregulates ALX/FPR2 levels. [score:6]
To analyze the relationship between miR-181b and, we downregulated miR-181b using a specific inhibitor (Fig.   2C). [score:6]
Human MΦs were transfected with 10 nM miR-181b inhibitor (single-stranded modified RNA, miScript, Qiagen, Milan, Italy) or non -targeting single-strain RNA (Qiagen) using the INTERFERin reagent (Polyplus Transfection) as reported [26]. [score:5]
MΦs were transfected with 10 nM miR-181b inhibitor or non -targeting single-strain RNA vector using INTERFERin (Polyplus Transfection TM) and seeded in 24-well plates (2.5 − 5 × 10 [5] cells/well) 24 h post transfection. [score:5]
CFBE41o- cells, transfected with 10 nM miR-181b inhibitor or non -targeting negative control single-strain RNA vector using INTERFERin (Polyplus Transfection TM) were seeded (6 × 10 [5] cells/well) in Transwell permeable supports (6.5 mm insert, 24 well plate) (Corning, NY, USA) 24 h post transfection. [score:5]
In the specific case of CF, a direct correlation between the genetic defect and miR-181b upregulation appears to occur. [score:5]
In conclusion, here we uncovered the upregulation of miR-181b in CF cells, which contributes to impair the endogenous anti-inflammatory, anti-microbial defense pathway centered on the ALX/FPR2 receptor. [score:4]
We present evidence of miR-181b upregulation in CF respiratory epithelial cells as well as in CF monocyte-derived macrophages (Figs  1 and 3). [score:4]
Pierdomenico AM MicroRNA-181b regulates ALX/FPR2 receptor expression and proresolution signaling in human macrophagesJ. [score:3]
Thus, targeting miR-181b may represent a novel strategy to enhance anti-inflammatory and anti-microbial defense mechanisms in CF. [score:3]
However, when these cells were transfected with the miR-181b inhibitor, an almost full recovery of LXA [4]- induced phagocytosis was observed, particularly at lower LXA [4] concentrations (Fig.   4C and D). [score:3]
Collectively, these results demonstrate that changes in miR-181b expression impair the ALX/FPR2 proresolution signaling in CF cells. [score:3]
In MΦs, a miR-181b inhibitor normalized LXA [4]-triggered phagocytic activity (Fig.   4). [score:3]
For CFBE41o- transfection, miR-181b inhibitor and negative control were diluted with 200 µl of Opti-MEM (Invitrogen, ThermoFisher Scientific, Waltham, MA USA) and combined with 4 µl of INTERFERin for 10 min at room temperature. [score:3]
Although the relevance of these changes remains to be determined in CF cells, our results clearly demonstrate that miR-181b controls ALX/FPR2 protein expression in both CF respiratory cells and MΦs (Figs  2 and 4). [score:3]
To obtain further evidence of a “cause and effect” relationship between miR-181b and ALX/FPR2, we transfected CF-MΦs with a miR-181b inhibitor. [score:3]
Herein, we provide evidence that miR-181b is overexpressed in CF cells, impairing the ALX/FPR2 -dependent pathway of inflammation resolution. [score:3]
Bars are mean ± SEM; **p = 0.0027 (C) CFBE41o- were transfected with a miR-181b inhibitor. [score:3]
We in fact observed that miR-181b expression is under the control of CFTR. [score:3]
Notably, in normal MΦs CFTRinh-172, a selective CFTR inhibitor [29], for 24 h, enhanced miR-181b (~ + 60%; p = 0.001) and reduced (~ − 30%; p = 0.0019), reminiscent of the CF- MΦs profile (Fig.   3C and D). [score:3]
On the other hand, under the present experimental settings, we were unable to detect significant changes in the release of selected cytokines by airway cells, in the presence or not of miR-181b inhibitor. [score:3]
Therefore, we asked whether the ALX/FPR2- LXA [4] circuit and its regulation by miR-181b was altered in CF. [score:2]
We exposed MΦs to increasing concentration of LXA [4] (0.001–10 nM) and compared the phagocytic capability of healthy (HS) MΦs, CF-MΦs and CF-MΦs transfected with a miR-181b inhibitor. [score:2]
Figure  2 shows that CFBE41o- cells expressed higher miR-181b levels compared to 16HBE14o- and CFBE41o-/WT cells. [score:2]
Next, we determined whether miR-181b -mediated regulation of ALX/FPR2 had an impact on agonist-evoked biological responses. [score:2]
For instance, miR-181b regulates TNF-α -induced transcription of pro-inflammatory genes in liver cells [35]. [score:2]
Whether ion fluxes are also involved in CFTR -dependent miR-181b regulation remains to be determined. [score:2]
We previously identified miR-181b as a main epigenetic regulator of [26]. [score:2]
miR-181b expression was evaluated by real-time PCR 24 h post transfection. [score:1]
We also evaluated the impact of miR-181b inhibition on the release of selected cytokines (IL-8, IL-6, RANTES) by CFBE41o- cells, exposed or not to LXA [4]. [score:1]
miR-181b and in CF macrophages. [score:1]
miR-181b analysis. [score:1]
miR-181b relative abundance was quantitated using the 2 [−ΔΔCt] method [47]. [score:1]
Sun X MicroRNA-181b regulates NF-κB -mediated vascular inflammationJ. [score:1]
Here, we tested the hypothesis that the lower in CF cells was related to changes in miR-181b level. [score:1]
Given the pivotal role of macrophages (MΦs) in inflammation resolution [30] and the capability of LXA [4] to stimulate ALX/FPR2 -dependent pro-resolving signaling in these cells [31], we determined miR-181b and ALX/FPR2 levels in MΦs isolated from CF patients and age-matched healthy subjects. [score:1]
miR-181b levels were determined by real-time PCR. [score:1]
More recently, a role of miR-181b in atherosclerosis and aneurysms has been proposed [37]. [score:1]
Real-time PCR analysis showed that miR-181b levels were reduced by ~ 70% (p = 0.0013) in transfected cells. [score:1]
Along these lines, the downstream signaling leading to the enhanced LXA [4] -induced phagocytic activity, observed when miR-181 was inhibited, requires further investigation. [score:1]
Moreover, in both cell types, by acting on miR-181b it was possible to enhance the functional responses of the pro-resolution agonist LXA [4]. [score:1]
Di Gregoli K MicroRNA-181b Controls Atherosclerosis and Aneurysms Through Regulation of TIMP-3 and ElastinCirc. [score:1]
These results confirm that by blocking miR-181b it is possible to enhance LXA [4] bioactions useful to control bacterial colonization in CF. [score:1]
miR-181b levels were determined as previously reported [26]. [score:1]
[1 to 20 of 49 sentences]
8
[+] score: 120
The level of miR-181b (C) was downregulated by the inflammatory stimulus and the treatment with everolimus restored their expression in these EC cultures as well. [score:6]
Importantly, the level of miR-181b was downregulated by the inflammatory stimulus (P<0.001) and the treatment with everolimus restored their expression in both EC cultures (P = 0.042, P = 0.049) (Fig 5B and S3C Fig). [score:6]
We provide some pieces of evidence that everolimus acts as a negative regulator of EC activation via suppressed NF-κB pathway with lower p65 translocation into cell nuclei, the modulation of the expression of SELE and VCAM-1 and their post-transcriptional repressor miR-181b at transcription level. [score:6]
We also studied the regulatory mechanisms how the expression of inflammation-specific miR-155 and E-selectin/VCAM-1 regulator miR-181b were modulated upon TNF-α stimulation of ECs in the presence or absence of everolimus. [score:5]
Importantly, we also observed that miR-181b targeted SELE and VCAM1 mRNAs, and TNF-α transcriptionally repressed miR-181b expression suggesting that TNF-α may enhance E-selectin and VCAM-1 at post-transcriptional level. [score:5]
In apolipoprotein E -deficient/NF-κB-luciferase transgenic mice miR-181b significantly inhibited atherosclerotic lesion formation, pro-inflammatory gene expression and the influx of lesional macrophages and CD4+ T cells in the vessel wall suggesting the central role of this miRNA in vascular inflammation during atherosclerosis [43]. [score:5]
Everolimus decreases EC activation via suppressing the NF-κB pathway with decreased p65 translocation into cell nuclei causing the modulation of E-selectin and VCAM-1 expression as well as miR-181b level at transcriptional and post-transcriptional level, respectively. [score:5]
0197890.g008 Fig 8 Everolimus decreases EC activation via suppressing the NF-κB pathway with decreased p65 translocation into cell nuclei causing the modulation of E-selectin and VCAM-1 expression as well as miR-181b level at transcriptional and post-transcriptional level, respectively. [score:5]
First, miR-155 was elevated by TNF-α compared to untreated sample, however, everolimus caused significantly decreased miR-155 levels (A), while miR-181b was downregulated by the inflammatory stimulus and the treatment with everolimus restored their expression in both EC cultures (B). [score:5]
Endothelial cell miR-181b regulates the SELE and VCAM1 expression. [score:4]
Here, Pearson’s correlation tests demonstrated a significant reverse correlation between plasma miR-181b levels and plasma VCAM-1 and E-selectin concentrations in our stented patient cohort supporting the relationship between the levels of this post-transcriptional regulator and the expression of these adhesive proteins. [score:4]
MiR-181b inhibits importin-α3 expression and NF-κB-responsive VCAM-1 and SELE genes [17]. [score:4]
These transcriptional (p65-bound eRNAs SELE_-11Kb and VCAM1_-10Kb) and post-transcriptional regulators (miR-181b) may represent potential therapeutic targets upon EC dysfunction. [score:4]
Based on all these data, we propose a mo del where everolimus acts as a negative regulator of EC activation via inhibiting NF-κB p65 subunit translocation resulting in altered E-selectin and VCAM-1 mRNA levels with their post-transcriptional repressor miR-181b at transcription level (Fig 8). [score:4]
Overexpression of miR-181b altered the levels of SELE and VCAM1 mRNA in HCAECs. [score:3]
Both HCAECs and HUVECs were treated by recombinant TNF-α for 1–4 hours to analyze miR-181b expression along with inflammation-specific miRNAs [25]. [score:3]
Based on our data, decreased plasma miR-181b level may be useful to indicate stent -induced EC activation with enhanced VCAM-1 and E-selectin expression. [score:3]
Plasma miR-155 (A) and miR-185 (B) were significantly upregulated in BMS patients with ISR compared to BMS and DES subjects without any complications, while miR-181b levels (C) were lower in those with ISR versus others without complication. [score:3]
The overexpression of miR-181b was produced by its specific mimic (Fig 6A), however, the levels of other miRNAs, e. g. miR-155, were not affected (data not shown). [score:3]
The overexpression of miR-181b was done using mirVana [®] miR-181b mimic (25 pmol, Ambion, Austin, TX, USA) with Lipofectamine RNAiMAX [®] Transfection Reagent (Invitrogen) for 24 hours at 37°C and 5% CO [2]. [score:3]
Based on these results, we confirmed that miR-181b targets E-selectin and VCAM-1 in HCAECs. [score:3]
HCAECs were treated by recombinant TNF-α for 1–4 hours to analyze miR-181b expression along with the inflammation-specific miR-155. [score:3]
In accordance with the former data of Sun et al. [17] and the effect of miR-181b on SELE/VCAM1 we detected (Fig 6), plasma miR-181b expression showed a significant negative correlation with VCAM-1 and E-selectin concentrations (r = -0.441, P = 0.019; r = -0.375, P = 0.049, respectively) (data not shown). [score:3]
Since miR-181b modulated VCAM-1 and E-selectin expression in HUVECs among in vitro conditions [17], we here analyzed the levels of this miRNA in TNF-α-stimulated ECs with or without everolimus as their potential key effector. [score:3]
These findings suggest that miR-155 (C, E) and miR-181b (D, F) expression were modulated at transcription level by TNF-α stimulation and everolimus in ECs. [score:3]
Transfection of HCAECs with miR-181b mimic. [score:1]
Levels of pre- and pri-miRNA were altered in the same manner as seen in mature miR-155 (C, E) and miR-181b (D, F), respectively. [score:1]
The transfection of ECs with specific miR-181b mimic was performed based on the manufacturer’s instructions. [score:1]
Impaired plasma miR-181b correlates with increased plasma levels of related soluble E-selectin and VCAM-1 concentrations. [score:1]
Quantification of TNF-α induced miR-146a, miR-155 and miR-181b levels upon inflammation in HUVECs in vitro. [score:1]
Total RNA was then extracted for the quantification of E-selectin and VCAM-1 mRNAs as well as miR-181b using RT-qPCR. [score:1]
Quantification of circulating miR-155, miR-185 and miR-181b by RT-qPCR in plasma samples of BMS and DES patients. [score:1]
Pearson’s correlation coefficient (r) was used to explore relationship between the levels of soluble adhesive receptors and circulating miR-181b. [score:1]
Despite some former available data revealed in HUVECs [17], we wanted to confirm the relationship between miR-181b and SELE and VCAM1 in HCAECs stimulated with TNF-α by using transfection of specific miR-181b mimic. [score:1]
Finally, correlation tests were performed to study the relationship between plasma VCAM-1 or E-selectin concentrations and miR-181b levels in the pooled patient samples. [score:1]
0197890.g005 Fig 5Quantification of TNF-α induced miR-155 and miR-181b levels with the analysis of their precursors in the presence of everolimus upon EC inflammation in vitro. [score:1]
Therefore, the levels of pre- and pri-miR-155, and both precursors of miR-181b were quantified by RT-qPCR in HCAECs stimulated with TNF-α with or without everolimus (Fig 5C–5F). [score:1]
The circulating level of miR-155, miR-185 and miR-181b were quantified by RT-qPCR in the plasma samples of the entire patient population. [score:1]
In addition, EC activation -dependent VCAM-1 and E-selectin were modulated by miR-181b [17]. [score:1]
Thus, more data are needed to observe the relationship of miR-181b level with soluble E-selectin/VCAM-1 concentrations as a potential biomarker of EC activation and ISR. [score:1]
TNF-α induced EC inflammation was associated with decreased miR-181b. [score:1]
After transfection, miR-181b with SELE and VCAM1 mRNAs were quantified by RT-qPCR. [score:1]
Quantification of TNF-α induced miR-155 and miR-181b levels with the analysis of their precursors in the presence of everolimus upon EC inflammation in vitro. [score:1]
S3 FigQuantification of TNF-α induced miR-146a, miR-155 and miR-181b levels upon inflammation in HUVECs in vitro. [score:1]
[1 to 20 of 44 sentences]
9
[+] score: 120
The results showed that miR-181 overexpression significantly decreased the luciferase activity, and mutations in the miR-181 binding site from the DAX-1 3′-UTR abolished this effect, suggesting that miR-181 directly inhibited DAX-1 expression by targeting the 3′-UTR (Fig. 4B). [score:11]
miR-181 targets the DAX-1 3′-untranslated region (3′-UTR) and downregulates its expression. [score:10]
They demonstrate that miR-181 overexpression causes the upregulation of AR target genes, suggesting that the proliferative role of miR-181, at least in part, may be dependent on androgen signaling. [score:8]
In the present study, elevated expression levels of AR target genes and proteins, including prostate-specific antigen, cyclin -dependent kinase (CDK) 1 and CDK2, was observed in LNCaP cells overexpressing miR-181 (Fig. 5). [score:7]
Therefore, these results suggest that miR-181 may negatively regulate DAX-1 expression at the translational level in LNCaP cells. [score:6]
In order to understand the underlying mechanism, potential targets of miR-181 were determined using TargetScan software. [score:5]
Previous studies have demonstrated that the upregulation of hepatic miR-181 promotes the growth, clonogenic survival, migration and invasion of hepatocellular carcinoma cells (7, 8). [score:4]
It was found that miR-181 is significantly upregulated in cancer tissues compared with that in normal adjacent tissues, as shown in Fig. 1. Since miR-181 was found to be upregulated in prostate cancer tissues, the effect of miR-181 on prostate cancer cell growth was investigated. [score:4]
Furthermore, in the present study DAX-1 was identified as a direct target of miR-181 in prostate cancer cells. [score:4]
miR-181 is upregulated in prostate cancer tissues. [score:4]
In addition, miR-181 overexpression was observed to promote the growth of LNCaP tumors in nude mice. [score:3]
The results suggest that miR-181 may be a potential therapeutic target for the treatment of prostate cancer in the future. [score:3]
The expression of miR-181 was analyzed in prostate cancer tissues and adjacent normal tissues using qPCR. [score:3]
DAX-1 was identified as a potential target of miR-181. [score:3]
In addition, the average tumor weight was significantly increased by miR-181 overexpression (Fig. 3C), suggesting that miR-181 may promote tumor growth in vivo. [score:3]
Furthermore, miR-181 overexpression decreased the percentage of cells in the G1 phase and increased the percentage of cells in the S phase (Fig. 2D). [score:3]
miR-181 overexpression promotes prostate cancer cell proliferation in vitro. [score:3]
Furthermore, the expression level of miR-181 is significantly associated with overall survival in hematological malignancies and may be an important clinical prognostic factor for patients with hepatocellular carcinoma (9). [score:3]
Therefore, in the present study, the expression of miR-181 was determined in prostate cancer tissues. [score:3]
A total of 2×10 [5] LNCaP cells stably expressing miR-181 or NC were injected subcutaneously into the dorsal flank of the mice. [score:3]
In the present study, it was demonstrated for the first time, to the best of our knowledge, that miR-181 overexpression may promote cell proliferation and cell-cycle progression in LNCaP cells. [score:3]
In combination, these results further confirm that DAX-1 is an important target gene of miR-181 in prostate cancer cells. [score:3]
Mutations were introduced in potential miR-181 binding sites using a site-directed mutagenesis kit (Qiagen). [score:3]
miR-181 overexpression promotes tumor growth in vivo. [score:3]
Therefore, miR-181 may be an onco-miRNA in the development of prostate cancer. [score:2]
To analyze miR-181 expression, specific stem-loop reverse transcription primers (Invitrogen Life Technologies) were used. [score:2]
The tumor size and volume were markedly increased in mice injected with LNCaP cells overexpressing miR-181 compared with those in control mice (Fig. 3A and B). [score:2]
To investigate whether DAX-1 may be directly targeted by miR-181, a luciferase reporter vector was constructed, containing the putative miR-181 binding sites within the DAX-1 3′-UTR. [score:2]
To further investigate the function of miR-181 on tumor growth in vivo, LNCaP cells with stable overexpression of miR-181 were generated and injected subcutaneously into the dorsal flank of nude mice. [score:1]
Notably, the 3′-UTR of DAX-1 mRNA was observed to contain a complementary site for the seed region of miR-181 (Fig. 4A). [score:1]
Furthermore, miR-181 mimics decreased the endogenous protein levels of DAX-1, as indicated by western blot analysis (Fig. 4C), while the DAX-1 mRNA levels remained unchanged (Fig. 4D). [score:1]
LNCaP cells were transfected with miR-181 mimics or NC (Fig. 2A). [score:1]
In conclusion, the present study provides a novel role for miR-181 in prostate cancer cell proliferation. [score:1]
Furthermore, the targets of miR-181 were investigated in order to determine the underlying mechanism of miR-181 in prostate cancer. [score:1]
Human miR-181 mimics and negative controls (NC) were purchased from Qiagen (Shanghai, China). [score:1]
[1 to 20 of 35 sentences]
10
[+] score: 105
In keeping with these observations, and based on the identification of STAT3 binding motifs in the promoter region of a panel of selected miRs, we experimentally validated that MDDCs treated with gp120, show a down-regulation of miR-21 and miR-155 expression, whereas miR-181b is up-regulated at late time points. [score:9]
Fig.   4 shows the network of interactions, which may be deregulated upon exposure of MDDCs to gp120 as a consequence of the altered expression of target genes, resulting from deregulation of miR-21, miR-155 and miR-181b. [score:7]
The majority of genes (863 for miR-155, 1889 for miR-181b and 645 for miR-21) are targeted by only one miRMiRs can regulate many target genes and modulate multiple pathways at the same time. [score:6]
The majority of genes (863 for miR-155, 1889 for miR-181b and 645 for miR-21) are targeted by only one miR MiRs can regulate many target genes and modulate multiple pathways at the same time. [score:6]
We provide evidence that exposure of monocyte-derived dendritic cells (MDDCs) to recombinant HIV-1 R5 gp120, but not to CCR5 natural ligand CCL4, influences the expression of a panel of miRs (i. e., miR-21, miR-155 and miR-181b) regulated by STAT3 and potentially targeting genes belonging to the STAT3 signaling pathway. [score:6]
This analysis led to a restricted list of 14 miRs potentially regulated by STAT3 and targeting genes annotated in the STAT3 signaling pathway (Biocarta) that is shown in Table  2. Detailed information on this analysis is provided in additional file 2. Interestingly, some of the miRs reported in Table  2 (i. e., miR-21, miR-125b, miR-135b, miR-181b and miR-155) were already predicted to be regulated by STAT3 and also experimentally validated [16, 18– 21]. [score:5]
The complete list of target genes for each of these three gp120-modulated miRs is reported in Additional file 4. We found that miR-21, miR-155 and miR-181b targeted 1119, 1468 and 2617 genes, respectively. [score:5]
In keeping with these observations, we showed a striking direct relationship between STAT3 activation and expression of miR-21 and miR-181b since the gp120 -induced deregulation of both miRs is completely reverted in the presence of Stattic. [score:5]
Then, to better define the role of STAT3 in the gp120 -induced modulation of miR-21 and miR-181b, we assessed the expression profile of these miRs in the presence of Stattic, a non-peptidic small molecule inhibiting STAT3 activation and dimerization [22]. [score:5]
The numbers in the intersections represent the number of target genes (390, 259 and 136) targeted by two miRs (miR-155 and miR-181b, miR-181b and miR-21 and miR-21 and miR-155, respectively) or by all of them (79 genes). [score:5]
Remarkably, the most significant (p < 0.05) categories of biological processes identified for miR-155 and miR-181b were transcription, regulation of transcription, regulation of RNA metabolic process, DNA -dependent regulation of transcription (Table  4). [score:4]
As shown in Fig.   1, miR-21 (A) and miR-181b (B) were down- and up-regulated, respectively, in cells treated with R5 gp120 at 18 h. Conversely, no significant difference was observed at 6 h. Likewise, gp120 treatment did not result in any significant modulation of miR-125b, whereas miR-135b did not amplify (data not shown). [score:4]
By taking the combined list of unique predictions for miR-21, miR-155 and miR-181b, the bioinformatics analysis outlined the term ‘regulation of transcription’ as the biological process with the highest number of annotated targets (772 genes) (Table  4). [score:4]
Additional file 5: List of the common 79 genes targeted by the STAT3-regulated miR-21, miR-155 and miR-181b. [score:4]
We found that gp120-triggered STAT3 activation directly influenced the expression of miR-21, miR-181b and miR-155. [score:4]
Although the addition of Stattic did not per se modulate the baseline expression levels of these miRs, it completely abolished the gp120 -induced down-modulation of miR-21 (C) as well as the up-modulation of miR-181b (D), thus confirming a role for STAT3 in the regulation of these miRs in MDDCs. [score:4]
Three different colored dots were placed next to genes to indicate the putative targeting by miR-155 (red dot), miR-181b (green dot) or miR-21 (blue dot). [score:3]
p values were calculated by ANOVA and statistical significance is indicated vs untreated control In keeping with our previous observation that CCL4 does not affect the STAT3/IL-6 axis [14], this chemokine, known as the most specific natural ligand engaging CCR5, did not alter the expression of miR-21, miR-155 and miR-181b expression, as well as that of miR-146 (Table  3). [score:3]
Gene Ontology of miR-21, miR-155 and miR-181b predicted targets. [score:3]
Additional file 4: Complete list of genes targeted by the gp120-modulated miR-21, miR-155 and miR-181b taken individually. [score:3]
p values were calculated by ANOVA and statistical significance is indicated vs untreated controlIn keeping with our previous observation that CCL4 does not affect the STAT3/IL-6 axis [14], this chemokine, known as the most specific natural ligand engaging CCR5, did not alter the expression of miR-21, miR-155 and miR-181b expression, as well as that of miR-146 (Table  3). [score:3]
Venn diagram showing the overlap between predicted target genes of miR-155 (red circle), miR-181b (green circle) and miR-21 (blue circle). [score:3]
A growing body of evidence demonstrates that STAT3 signaling pathway is closely associated with the transcriptional regulation of some miRs including miR-21 and miR-181b [19, 47] as well as miR-155 [16, 18]. [score:2]
By this in-house R bioconductor script we obtained the combined list of unique predictions for miR-21, miR-155 and miR-181b. [score:1]
Relative fold of change of expression of miR-21 a-c, miR-181b (B-D), in gp120 stimulated MDDCs against untreated controls were calculated using the comparative Ct (2 [-ΔΔCt]) method. [score:1]
[1 to 20 of 25 sentences]
11
[+] score: 88
We also found that CARM1 was post-transcriptionally regulated and was directly targeted by miR-181, which represses the 3′ untranslated region (3′UTR) of CARM1 in hESCs. [score:7]
In differentiated hESCs, H3K27 methylation is inhibited because of the reduction of core pluripotency factors, and miR-181 family members are consequently significantly induced and down-regulate CARM1 activity. [score:6]
In this context, we scanned for microRNAs that target CARM1 and finally identified the miR-181 family as the critical regulator of CARM1 expression. [score:6]
In differentiated hESCs, H3K27 methylation is inhibited due to the reduction of core pluripotency factors, and miR-181 family members are subsequently induced and down-regulate CARM1 activity. [score:6]
Taken together, these results show that miR-181 directly regulates CARM1 by targeting its 3′UTR and that miR-181c may play a prominent role among the 4 members during hESC differentiation. [score:5]
Although the miR-181 family also regulates many target genes [21], [46], [47], [48], [49], it is important to highlight that in mouse ESCs, the miR-181 family regulates another histone modulator, Cbx7, which plays a critical role in maintaining ESC pluripotency [50]. [score:5]
0053146.g002 Figure 2The miR-181 family directly regulates CARM1 expression in hESC. [score:5]
To investigate whether CARM1 can be directly targeted by miR-181, we engineered luciferase reporters that have either the wild-type 3′UTR of CARM1, or a mutant 3′UTR with three point mutations in the target sites as a negative control (Fig. 2C). [score:5]
The miR-181 family directly regulates CARM1 expression in hESC. [score:5]
Enforced Expression of miR-181c Induced hESC Differentiation by Targeting CARM1 We selectively transfected miR-181c mimics in undifferentiated hESCs to study the effect of miR-181 on hESCs differentiation. [score:5]
All the results indicated that CARM1 down-regulation may greatly contribute to the miR-181-meidated hESC differentiation. [score:4]
Future studies will explore how the expression of the miR-181 family is regulated in ESC differentiation and whether other transcriptional factors are associated with CARM1. [score:4]
By contrast, the expression of mutant reporters was not repressed by miR-181 (Fig. 2D). [score:3]
Thus, we suggest that CARM1 is one of the key target genes of the miR-181 family during the progression of ESCs differentiation. [score:3]
We also found that the expression levels of the miR-181c/d primary transcripts (pri-181c/d) were notably elevated after differentiation in comparison to the primary transcripts of miR-181a and miR-181b (pri-181a1/b1 and pri-181a2/b2) (Fig. 2B). [score:3]
Our work suggests that downstream targets of the miR-181 family include epigenetic factors that reconfigure the H3 arginine methylation signature during the process of hESC differentiation. [score:3]
Considering that the sites of the CARM1 3′UTR that are targeted by miR-181 family members are conserved in mammals, we suppose that the interaction between miR-181 and CARM1 is conserved in mESCs. [score:3]
The mature transcripts of the 4 members of the miR-181 family were all found to be significantly increased in differentiated hESCs, and miR-181c had the highest expression level (Fig. 2A). [score:3]
miR-181 Family Members are Critical Regulators of CARM1 during hESC Differentiation. [score:2]
Our results also suggest that the miR-181/CARM1/core-pluripotency-factors regulatory loop may be a novel mo del pathway involved in the modulation of hESC pluripotency (Figure 4E). [score:2]
We selectively transfected miR-181c mimics in undifferentiated hESCs to study the effect of miR-181 on hESCs differentiation. [score:1]
To study the role of endogenous miR-181 in repressing the CARM1 3′UTR reporter in differentiated hESCs, we co -transfected the wild-type 3′UTR luciferase reporter and the negative control luciferase into differentiated hESCs. [score:1]
This finding suggests that the miR-181 family may also promote differentiation by affecting histone modulation in mESCs. [score:1]
[1 to 20 of 23 sentences]
12
[+] score: 72
Downregulation of miR-181b in human gastric tissues could elevate the expression of cAMP responsive element binding protein1 (CREB1) that suppressed the proliferation and colony formation rate of gastric cancer cells [32]. [score:8]
Further studies reported that overexpression of miR-181b could regulate tamoxifen resistance in breast cancer by downregulating TIM3 and facilitating growth factor signaling [31]. [score:7]
MiR-181b was downregulated in acute promyelocytic leukemia (APL) cell line NB4 after giving treatment with pharmacological does of all-trans retinoic acid (ATRA) [45], whereas high expression miR-181a could sensitize APL cell lines HL-60 to Ara-C treatment [46]. [score:6]
Likewise, miR-181b can enhance matrix metallopeptidases (MMP) 2 and MMP9 activity and promoted growth, clonogenic survival, migration and invasion of hepatocellular carcinoma (HCC) cells by modulating a tumor suppressor, the tissue inhibitor of metalloprotease 3 (TIM3). [score:5]
First, the heterogeneity existed in our meta-analysis and was probably due to the differences in baseline demographic characters of population, the tumor types, the disease stages, the cut-off value of miR-181 expression, the duration of follow-up, etc. [score:5]
Figure S1 Target genes of miR-181a and miR-181b. [score:3]
Notably, miR-181b has the same expression pattern as miR-181a in human cancers. [score:3]
Third, the precondition of our study is that miR-181a and miR-181b are co-expressed in cancers and playing an important role together in tumorigenesis. [score:3]
Depletion of miR-181b inhibited tumor growth of HCC cells in nude mice [30]. [score:3]
Li et al. and Zhu et al. examined MiR-181a and miR-181b respectively in the same population [19], [27], whereas Yang et al. studied the patients with both miR-181a and miR-181b overexpression [26]. [score:3]
MiR-181 family is one of those miRNA families, which generally express in 70 species and various human cancers [6]. [score:3]
Although the seed region of miR-181a and miR-181b is highly aligned and most of their predicted targeted genes are overlapped, they might act differently in different kinds of cancers. [score:3]
However, the subgroup analysis showed that low expression level of miR-181a, but no miR-181b (data no show), was significantly relative to poor survival outcome in patients. [score:3]
In recent years, the miR-181 family was found dysregulated in a variety of human cancers and significantly associated with clinical outcome of cancerous patients. [score:2]
These findings indicated the significance of miR-181 in human hematopoietic development. [score:2]
MiR-181 preferably expresses in hematopoietic cell lineages and is involved in erythropoiesis, granulocytic and megakaryocytic differentiation [33]– [36]. [score:2]
Among them, miR-181a and miR-181b (miR-181a/b) which locate on the same loci of chr1q31.3 and chr9q3.33 are the most studied. [score:1]
This family includes 4 members (miR-181a, miR-181b, miR-181c and miR-181d) and they are highly conserved in the seed-region sequence and RNA secondary structure. [score:1]
For PubMed, the contextual query language (CQL) was “ (mir-181[Title/Abstract]) OR (microRNA-181[Title/Abstract]) OR (mir-181a[Title/Abstract]) OR mir-181b[Title/Abstract]”; for EMBASE, the CQL was “(mir-181 or microRNA-181 or mir-181a or mir-181b). [score:1]
We presumed that miR-181a and miR-181b may have the same effect on patients’ survival. [score:1]
Forest plots of studies evaluating HR of overall survivals comparing high and low miR-181 expression. [score:1]
In the studies which reported the HR data of miR-181a and miR-181b respectively in a same set of patients, the combined HR was estimated by simply taking the square-root of multiplying two HR data. [score:1]
The importance of miR-181 in hematopoiesis leaded most studies to focus on the role of miR-181 family in hematological malignancies. [score:1]
First, lack of abundant miR-181a/b expression data in global population makes it difficult to set a standard value for the measurement of miR-181/b. [score:1]
Most of the studies used quantification real-time PCR to measure the expression level of miR-181 (TaqMan: 6 and Stem-loop: 2), and others used microarray method. [score:1]
In recent years, miR-181 family has been found associated with tumorigenesis. [score:1]
In situ hybridization (ISH) in tonsil tissue sections showed gradual decrease of miR-181b staining intensity from the dark to the light zone in germinal center B cells [38]. [score:1]
[1 to 20 of 27 sentences]
13
[+] score: 59
A comprehensive list of potential miRNA targets for AML therapy is summarized in Table 2. Table 2 miRNA target genes or pathways References miR-141 PI3K/Akt/mTOR[113] miR-125a ErbB pathway[10] miR-125b Mcl-1[11, 12] miR-22-3p, let-7e-5p PLK1[114] miR-34a PD-L1[80] miR-638 CDK2[34] miR-181a, b and c PRKCD, CTDSPL and CAMKK1[6, 36, 96, 97] miR-191-5p, miR-142-3p PPP2R2A[19, 115] miR-181b MDR[36] miR-21, miR-196b HOX[98] miR-29a/b/c Dnmts[19, 22] Both single miRNAs and panel of miRNAs have potential prognostic value complementing information gained from cytogenetics, gene mutations, and altered gene expression. [score:8]
One of the underlying mechanisms is that miR-181b binds to the 3′-untranslated regions of HMGB1 and Mcl-1 and inhibits their expression. [score:7]
miR-181 inhibits differentiation of AML cells into granulocytes and macrophages by down -regulating their direct targets PRKCD, CTDSPL, and CAMKK1 and then affecting the PRKCD-P38-C/EBPα pathway and reducing pRB phosphorylation. [score:7]
Expression of all miR-181 family members was reduced in adult AML patients (M1-M3 subtypes), suggesting all function as tumor suppressors. [score:5]
The in vivo expression of miR-181 partially reversed the lack of myeloid differentiation in AML patients and in the mice with CD34 [+] HSPCs from AML patients [37] It has been demonstrated that, in normal hematopoiesis, some miRNAs were involved in progenitor lineage commitment[38] and controlling HSC [39- 41] by coordinate repression of multiple targets [42]. [score:5]
The down-regulation of miR-181 was associated with leukemia invasiveness, and miR-181 has been well studied to be a prognostic predictor of AML [6, 36, 96, 97]. [score:4]
However, the temporal expression of miR-181b is also critical in determining the chemo-sensitivity in AML [91]. [score:3]
In AML CD34 [+] HSPC xenograft mice, inhibition of miR-181 increased differentiation of myeloid progenitors, reduced engraftment and infiltration of leukemic HSPCs into bone marrow and spleen, and ameliorated symptoms of leukemia. [score:3]
Leukemia cells overexpressing miR-181b, on the other hand, are more sensitive to cytotoxic chemotherapeutic agents and prone to drug -induced apoptosis. [score:3]
Su et al [37] demonstrated that miR-181 inhibition is a potential new treatment strategy for AML. [score:3]
These findings suggest that miR-181 is a potential target for AML therapy. [score:3]
It's shown that the expression of miR-181a and miR-181b was positively associated with good clinical outcome in molecular high-risk CN-AML and inversely associated with the risk of an event, such as failure to achieve complete remission, relapse, and even death. [score:3]
Knockdown of miR-181 in cultured bone marrow blasts from AML patients partially reversed blockage of myeloid differentiation. [score:2]
Accumulating evidence indicates that the miR-181 family plays important roles in AML pathogenesis [36]. [score:1]
These results demonstrate critical but complex roles of miR-181 in AML, and more importantly, the temporal changes of miRNA expression and function during AML progression highlight a rigorous evaluation of miRNA -based therapy in AML. [score:1]
Human multidrug-resistant leukemia cells and relapsed/refractory AML patients have significantly lower levels of miR-181b. [score:1]
[1 to 20 of 16 sentences]
14
[+] score: 59
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-25, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-198, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181c, hsa-mir-182, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-142, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-362, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-382, hsa-mir-340, hsa-mir-328, hsa-mir-342, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-335, hsa-mir-345, hsa-mir-196b, hsa-mir-424, hsa-mir-425, hsa-mir-20b, hsa-mir-451a, hsa-mir-409, hsa-mir-484, hsa-mir-486-1, hsa-mir-487a, hsa-mir-511, hsa-mir-146b, hsa-mir-496, hsa-mir-181d, hsa-mir-523, hsa-mir-518d, hsa-mir-499a, hsa-mir-501, hsa-mir-532, hsa-mir-487b, hsa-mir-551a, hsa-mir-92b, hsa-mir-572, hsa-mir-580, hsa-mir-550a-1, hsa-mir-550a-2, hsa-mir-590, hsa-mir-599, hsa-mir-612, hsa-mir-624, hsa-mir-625, hsa-mir-627, hsa-mir-629, hsa-mir-33b, hsa-mir-633, hsa-mir-638, hsa-mir-644a, hsa-mir-650, hsa-mir-548d-1, hsa-mir-449b, hsa-mir-550a-3, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-454, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-708, hsa-mir-216b, hsa-mir-1290, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-3151, hsa-mir-320e, hsa-mir-378c, hsa-mir-550b-1, hsa-mir-550b-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
Finally with regard to miRNAs and CLL, miR-181b was frequently down-regulated in CLL patients with disease progression [18, 19] as it targets MCL-1 and BCL2 [18], which are important for cancer cell survival, and low expression of this miRNA was associated with poor prognosis as indicated by treatment-free survival (TFS) [18, 19]. [score:10]
In analysis of the expression of the meningioma 1 (MN1) gene and MN1 -associated microRNA in Chinese adult de novo acute myeloid leukemia (AML) patients, Xiang found that increased expression of MN1 was associated with reduced miR-20a expression and increased miR-181b expression. [score:9]
Drug resistance is the main reason for AML relapse and poor prognosis and, since miR-181b can increase AML drug sensitivity through down-regulation of HMGB1 and MCL-1, it is not surprising that miR-181b was down-regulated in relapsed and refractory AML patients [104]. [score:7]
Lower expression of miR-181b, miR-29c and miR-223 was associated with disease progression in CLL patients and this correlates with unfavorable prognosis, such as shorter progression-free survival and overall survival [23, 30– 33]. [score:5]
Up-regulated circulating miR-181b-5p was associated with shorter overall survival [125] and was found in patients with a lower complete remission rate, shorter relapse-free survival and shorter overall survival [105]. [score:4]
The miR-15/16 cluster, miR-34b/c, miR-29, miR-181b, miR-17/92, miR-150, and miR-155 represent the most frequently deregulated miRNAs reported in CLL, and these microRNAs have been associated with disease progression, prognosis, and drug resistance [1] (Table  1). [score:4]
High miR-181 expression is also associated with a better clinical outcome in CN-AML [101, 102] through reverse regulation of toll-like receptors and interleukin-1β. [score:4]
miR-181b affected the expression of TCL1, Bcl2 and Mcl1 anti-apoptotic factors, and reduced the levels of Akt and phospho-Erk1/2 [135]. [score:3]
In contrast, high miR-181b expression was found in patients with a lower complete remission rate, shorter relapse-free survival and shorter overall survival [105]. [score:3]
In addition, circulating miR-155-5p and miR-181b-5p were up-regulated in AML patients when compared with normal controls [125]. [score:3]
In addition, after AML patients received double induction and one consolidation therapy, increased miR-181b expression was associated with worse complete remission rates, relapse-free survival and overall survival in adult patients with de novo AML [105]. [score:3]
In addition, miR-181 contributed to a better clinical outcome in cytogenetically abnormal AML patients [103] by regulation of HOXA7, HOXA9, HOXA11, and PBX3. [score:2]
In vivo study showed the capability of miR-181b to reduce leukemic cell expansion and to increase survival of treated mice. [score:1]
Bresin A, et al. miR-181b as a therapeutic agent for chronic lymphocytic leukemia in the Emicro-TCL1 mouse mo del. [score:1]
[1 to 20 of 14 sentences]
15
[+] score: 56
Moreover, restoring expression of miR-15a/16-1 indirectly affects expression of miR-34 family by modulating p53 expression and downregulation of miR-29 and miR-181b in aggressive CLL contributes to overexpression of Tcl1 [43]. [score:13]
We verified that coexpression of TCL1 with miR-29 and miR-181 decreased its expression and found inverse correlation between miR-29b, miR-181b, and Tcl1 expression in CLL samples [35]. [score:7]
The role of downregulation of miR-29 and miR-181b in aggressive CLLs appears to correlate with Tcl1 overexpression [35]. [score:6]
In the same study, miR-181b is also reported to target MCL1 in CLL, while in another study on human gastric and lung cancer cell lines, it was found able to target BCL2 and involved in the development of multidrug resistance [37]. [score:6]
MiR-15/16 cluster, miR-34b/c, miR-29, miR-181b, miR-17/92, miR-150, and miR-155 family members, the most deregulated microRNAs in CLL, were found to regulate important genes, helping to clarify molecular steps of disease onset/progression. [score:5]
MicroRNA-181b and microRNA-29In both indolent and aggressive CLLs, miR-29 is overexpressed when compared to normal B cells while miR-181b is downregulated when compared to normal B cells. [score:4]
In both indolent and aggressive CLLs, miR-29 is overexpressed when compared to normal B cells while miR-181b is downregulated when compared to normal B cells. [score:4]
BCR activation can lead to reduced levels of miR-29c, miR-150, miR-181b, or miR-223 [15], and low expression of these microRNAs was observed in patients with shorter survival and/or time to treatment [16]. [score:3]
Although, when comparing indolent and aggressive CLLs, both mir-29 and mir-181b show higher expression levels in indolent cases [34- 36]. [score:3]
Moreover, miR-181b expression is decreased during CLL progression when sequential samples from the same patients are compared [11]. [score:2]
Patients with high miR-21 and miR-155 had a higher risk of death compared to patients with low expression of these microRNAs [9, 10], and miR-181b can predict time to treatment, acting as a biomarker of progression [11]. [score:2]
MicroRNA-181b and microRNA-29. [score:1]
[1 to 20 of 12 sentences]
16
[+] score: 55
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7e, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-31, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-212, hsa-mir-181a-1, hsa-mir-221, hsa-mir-23b, hsa-mir-27b, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-200c, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-200a, hsa-mir-30e, hsa-mir-148b, hsa-mir-338, hsa-mir-133b, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-10b-1, dre-mir-181b-1, dre-mir-181b-2, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, dre-mir-203a, dre-mir-204-1, dre-mir-181a-1, dre-mir-221, dre-mir-222a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7e, dre-mir-7a-3, dre-mir-10b-2, dre-mir-20a, dre-mir-21-1, dre-mir-21-2, dre-mir-23a-1, dre-mir-23a-2, dre-mir-23a-3, dre-mir-23b, dre-mir-24-4, dre-mir-24-2, dre-mir-24-3, dre-mir-24-1, dre-mir-26b, dre-mir-27a, dre-mir-27b, dre-mir-29b-1, dre-mir-29b-2, dre-mir-29a, dre-mir-30e-2, dre-mir-101b, dre-mir-103, dre-mir-128-1, dre-mir-128-2, dre-mir-132-1, dre-mir-132-2, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-143, dre-mir-148, dre-mir-181c, dre-mir-200a, dre-mir-200c, dre-mir-203b, dre-mir-204-2, dre-mir-338-1, dre-mir-338-2, dre-mir-454b, hsa-mir-181d, dre-mir-212, dre-mir-181a-2, hsa-mir-551a, hsa-mir-551b, dre-mir-31, dre-mir-722, dre-mir-724, dre-mir-725, dre-mir-735, dre-mir-740, hsa-mir-103b-1, hsa-mir-103b-2, dre-mir-2184, hsa-mir-203b, dre-mir-7146, dre-mir-181a-4, dre-mir-181a-3, dre-mir-181a-5, dre-mir-181b-3, dre-mir-181d, dre-mir-204-3, dre-mir-24b, dre-mir-7133, dre-mir-128-3, dre-mir-7132, dre-mir-338-3
For instance, while miR-181b and miR-7 levels were highly upregulated in injured zebrafish and bichir fins, analysis of regenerating axolotl forelimbs showed expression levels were significantly downregulated. [score:9]
These studies confirmed miR-21, miR-181c and miR-31 were consistently upregulated in all three organisms and miR-181b and miR-7b were upregulated in both zebrafish and bichir (Fig 3). [score:7]
S22 Table Zebrafish Ensembl gene identifiers for 58 genes downregulated in three mo dels with predicted miRNA binding sites for miR-21, miR-181c, miR-181b, miR-31 and miR-7 and members of the network of commonly up- and downregulated genes with functional interactions to 11 blastema -associated genes. [score:7]
These filtering criteria identified 136 downregulated genes with predicted binding sites in the 3’-UTRs for any of the 5 common upregulated miRNAs (miR-21, miR-31, miR-181b, miR-181c and miR-7b) (S21 Table). [score:7]
Morphological and histological studies of miR-21, miR-31 and/or miR-181 inhibition combined with identification of target genes would demonstrate their roles in blastema formation. [score:5]
S21 Table Zebrafish Ensembl gene identifiers for 136 genes downregulated in three mo dels with predicted miRNA binding sites for miR-21, miR-181c, miR-181b, miR-31 or miR-7 in all three mo dels. [score:4]
Interestingly, erb-b2 receptor tyrosine kinase 2 (erbb2) was the only blastema -associated transcript predicted to be targeted by one of the common regulated miRNAs, miR-181b and miR-181c. [score:4]
Within this subset of differentially regulated zebrafish miRNAs, we identified 10 miRNAs: miR-21, miR-181c, miR-181b, miR-31, miR-7b, miR-2184, miR-24, miR-133a, miR-338 and miR-204, that showed conserved expression changes with both bichir and axolotl regenerating samples (Table 1). [score:4]
STRING interactions with 11 common blastema -associated genes, miR-21, miR-31, miR-181, and 50 additional common differentially expressed genes with common predicted miRNAs binding sites. [score:3]
Next, we established a gene network for common miRNA target genes for miR-21, miR-31 and miR-181. [score:3]
Although zebrafish miRNAs have been examined in numerous studies [25, 27, 41– 43], our analysis revealed novel paralogs of 18 miRNAs that do not currently have zebrafish records in miRBase (version 21), including miR-181a, miR-20a, miR-23b, miR-24, miR-29a, miR-103, miR-128, miR-148, miR-181b, miR-199, miR-204, miR-212, miR-221, miR-338, miR-724, miR-2184, let-7b and let-7e. [score:1]
In addition to rgs5, both bcl2l13 and chka had predicted binding sites for 4 miRNAs (miR-21, miR-181b, miR-181c and miR-7b). [score:1]
[1 to 20 of 12 sentences]
17
[+] score: 54
Overexpression of miR-181b potentiated the expression of the lymphatic gene, PDPN, but suppressed the expression of Ephrin B1 and NRP2, as compared to scramble sequence control samples (Fig. 6). [score:8]
Inhibition of miR-181b suppressed expression of the arterial genes, Ephrin B1, Ephrin B2, and Hey2 and induced expression of all lymphatic genes analyzed, FLT4, PDPN, and Prox1, when compared with control samples (Supporting Information Fig. S6). [score:8]
Expression is significantly augmented in response to LV -mediated overexpression of miR-99b, miR-181a and miR-181b, and suppressed in response to LV -mediated overexpression of a miRZipTM anti-sense microRNA RNAi hairpin, miR- 99b, miR-181a or miR-181b as compared to uninfected and scramble sequence controls (MOI 25). [score:8]
miR overexpression elicited a greater effect in H1 cells, resulting in a 33% (miR-99b, MFI: 27.5), 34% (miR-181a, MFI: 33.5), and 33% (miR-181b, MFI: 28.9) increase in cells expressing one or both Pecam1 and VE Cadherin at day 14 of differentiation (vs. [score:5]
A: mRNA expression of VE Cadherin and Pecam1 in H1 hES cells subject to LVmediated suppression of miR-99b, miR-181a, miR-181b, all together (miR ×3), or uninfected and scramble sequence controls. [score:5]
miR-99b, miR-181a, miR-181b or all together (miR ×3) overexpression suppresses NO production. [score:5]
Furthermore, we report that upon analysis of the cell population expressing both proteins and ability to produce NO, we noted that there was an increased response to miRNA overexpression for all three miRNAs, including miR-181b that did not evoke a significant response at the mRNA level, in the H1 hESC line, when compared with SA461 cells (Fig. 5). [score:4]
CD34 is expressed on mesoderm and early ECs [52] providing further evidence for a miR-181b role in early-stage commitment to EC differentiation. [score:3]
miR-181b has also previously been identified as expressed in CD34+ cells during hematopoietic differentiation from pluripotent cells [51]. [score:3]
Supplementary Figure 3: A: Expression of miR-99b, miR-181a and miR-181b in SA461 pluripotent D0 (white bars), D10 hES-EC (black bars), and adult SVEC cells (dark grey bars). [score:3]
B: Expression of miR-99b, miR-181a and miR-181b across a human tissue panel, compared to SA461 pluripotent D0. [score:2]
[1 to 20 of 11 sentences]
18
[+] score: 50
We should underline that some of these miRNAs (Table 3) are expressed in the 90% of the ES patients, such as the up-regulated miR-210 (11p15.5), Let-7a (9q22.32), Let-7e (19q13.41), miR-181b (1q32.1) and the down-regulated miR-1908 (11), miR-659 (22q13.1) and miR-937 (8q24.3). [score:9]
A more detailed representation of the up and down regulation of miRNAs is presented in Table 2. An interesting observation is that three of the four up-regulated miRNAs (miR-210, LET-7a, miR-181b) (Table 3) were also the most significant miRNAs, as shown in Table 2. The raw data of global miRNAs expression analysis is available at the Gene Expression Omnibus [15]. [score:9]
A more detailed representation of the up and down regulation of miRNAs is presented in Table 2. An interesting observation is that three of the four up-regulated miRNAs (miR-210, LET-7a, miR-181b) (Table 3) were also the most significant miRNAs, as shown in Table 2. The raw data of global miRNAs expression analysis is available at the Gene Expression Omnibus [15]. [score:9]
Interesting highlights in our findings are that let-7A/E and miR-181b are up-regulated in >90% of ES patients. [score:4]
Many reports demonstrated that miR-181a and miR-181b exhibit their action via targeting several genes such as BCL-2 and MCL-1 by direct binding to their 3′-UTR [25]. [score:4]
As shown in Figure 4, we identified the BCL-2 gene as being a specific target of miR-21, miR-181a, miR-181b, miR-29a, miR-29b, miR-497, miR-195, let-7a, miR-34a and miR-1915 (Figure 4 and Table 4). [score:3]
In our study, the expression profiles of 3 miRNAs such as miR-181b, miR-1915 and miR-1275 were confirmed by qRT-PCR. [score:3]
We have already described miR-181b and its target multiple apoptosis genes, such as BCL-2 and MCL-1. This miRNA was also associated to chronic lymphocytic leukemia and was shown to promote chemoresistance in pancreatic ductal adenocarcinoma cells and breast cancer [24]. [score:3]
Due to the limited amount of residual available RNA, only 11 ES samples were tested in duplicate qRT-PCR reactions for the expression of miR-181b, miR-1915 and miR-1275 (Figure 3). [score:3]
Aberrantly regulated miR-181a and miR-181b have been correlated with cancer progression and poor survival in cervical cancer, ovarian cancer and breast cancer. [score:2]
The function of miR-181a and miR-181b are complex, displaying either pro-proliferative or pro-apoptotic roles under specific physiological conditions and in different types of cancers. [score:1]
[1 to 20 of 11 sentences]
19
[+] score: 49
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-19a, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-30a, hsa-mir-33a, hsa-mir-96, hsa-mir-98, hsa-mir-103a-2, hsa-mir-103a-1, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-30a, mmu-mir-30b, mmu-mir-99b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-155, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-191, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-221, hsa-mir-223, hsa-mir-200b, mmu-mir-299a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-96, mmu-mir-98, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-148b, mmu-mir-351, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, mmu-mir-19a, mmu-mir-25, mmu-mir-200c, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-30c-1, hsa-mir-299, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-361, mmu-mir-361, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-375, mmu-mir-375, hsa-mir-148b, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, mmu-mir-433, hsa-mir-429, mmu-mir-429, mmu-mir-365-2, hsa-mir-433, hsa-mir-490, hsa-mir-193b, hsa-mir-92b, mmu-mir-490, mmu-mir-193b, mmu-mir-92b, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-299b, mmu-mir-133c, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
HDI Upregulates Selected miRNAs that Target AicdaWe have shown by qRT-PCR that miR-155, miR-181b, and miR-361, which silence AID by targeting Aicda 3′ UTR, were significantly upregulated by HDI (16). [score:11]
We have recently shown that HDI downregulated the expression of AID and Blimp-1 by upregulating miR-155, miR-181b, and miR-361, which silence Aicda mRNA, and miR-23b, miR-30a, and miR-125b, which silence Prdm1 mRNA, but not miR-19a/b, miR-20a, and miR-25, which are not known to regulate Aicda, Prdm1, or Xbp1 (16). [score:10]
In addition to the targeting sites for miR-155, miR-181b, and miR-361, the 3′ UTR of mouse Aicda mRNA also contains the putative target sites for miR-125a, miR-351, miR-92b, miR-26a, and miR-103 (identified by using miRNA -targeting prediction tools: TargetScan. [score:9]
We have further shown that HDI, such as VPA and butyrate, inhibit AID and Blimp1 expression by upregulating miR-155, miR-181b, and miR-361, which silenced AICDA/Aicda mRNA, and miR-23b, miR-30a, and miR-125b, which silenced PRDM1/Prdm1 mRNA (16). [score:8]
We have shown by qRT-PCR that miR-155, miR-181b, and miR-361, which silence AID by targeting Aicda 3′ UTR, were significantly upregulated by HDI (16). [score:6]
Some miRNAs, including miR-155, miR-181b, and miR-361, can silence AID expression, whereas miR-30a and miR-125b can silence Blimp-1 expression (16). [score:5]
[1 to 20 of 6 sentences]
20
[+] score: 48
miR-151a-3p (ΔΔCt = -2.01, P = 8.29E-06), MiR-181b-5p (ΔΔCt = -3.39, P = 1.04E-10), miR-320a (ΔΔCt = -2.47, P = 5.02E-12), miR-328 (ΔΔCt = -2.28, P = 4.33E-06), miR-433 (ΔΔCt = -2.33, P = 0.0001), miR-489 (ΔΔCt = -2.10, P = 1.25E-06), miR-572 (ΔΔCt = -2.47, P = 2.66E-08) and miR-663a (ΔΔCt = -2.06, P = 0.00002) were downregulated, while miR-101-3p (ΔΔCt = 1.43, P = 0.003), miR-106b-5p (ΔΔCt = 1.30, P = 0.008), miR-130a-3p (ΔΔCt = 2.35, P = 1.89E-09), miR-195-5p (ΔΔCt = 1.43, P = 0.0016) and miR-19b-3p (ΔΔCt = 1.87, P = 6.88E-09) were upregulated in the ASD individuals. [score:7]
MiR-151a-3p, miR-181b-5p, miR-320a, miR-328, miR-433, miR-489, miR-572, and miR-663a were downregulated, while miR-101-3p, miR-106b-5p, miR-130a-3p, miR-195-5p, and miR-19b-3p were upregulated. [score:7]
miR-151a-3p, miR-181b-5p, miR-320a, miR-328, miR-433, miR-489, miR-572 and miR-663a were downregulated while miR-101-3p, miR-106b-5p, miR-19b-3p, miR-195-5p, miR-130a-3p and miR-27a-3p were upregulated. [score:7]
MiR-151a-3p, miR-181b-5p, miR-320a, miR-328, miR-433, miR-489, miR-572 and miR-663a were downregulated, while miR-101-3p, miR-106b-5p, miR-19b-3p, miR-195-5p, miR-130a-3p and miR-27a-3p were upregulated. [score:7]
The differentially expressed miRNAs in this study, which included miR-101, miR-106b, miR-130a, miR-151a, miR181b, miR-328, miR-433, miR-489 and miR-572, were previously reported to have altered expression in schizophrenia [31- 35], supporting the contention that ASD and schizophrenia share common neurobiological features [36]. [score:5]
Collectively, these results predicted several neurologically relevant canonical pathways for the target genes of the five miRNAs (miR-130a-3p, miR-19b-3p, miR-320a, miR181b-5p, and miR-572) that showed a good discriminative power in ROC analysis. [score:3]
Therefore, hsa-miR-181b-5p and hsa-miR-328 in serum may become peripheral biomarkers reflecting the miRNA expression profile of individuals with ASD. [score:3]
The results of the present and previous studies are summarized in Table  2, in which hsa-miR-181b-5p, hsa-miR-195-5p, hsa-miR-320a and hsa-miR-328 showed the same direction of regulation as in the brain [13] and lymphoblasts [14- 16], while hsa-miR-106b-5p, hsa-miR-19b-30 and hsa-miR-663a did not. [score:3]
However, it was interesting that hsa-miR-181b-5p and hsa-miR-328 in serum showed the same direction of regulation as in the brain. [score:3]
The Ct values of nine miRNAs (miR-101-3p, miR-106b-5p, miR-151a-3p, miR-195-5p, miR-19b-3p, miR-27a-3p, miR-320a, miR-328, and miR-489) were in the range of 25–30, while the remaining five miRNAs (miR-130a-3p, miR-181b-5p, miR-433, miR-572, and miR-663a) had Ct values in the range of 30 to 35. [score:1]
High values for sensitivity, specificity and area under the curve (AUC) were observed for five miRNAs: miR-181b-5p, miR-320a, miR-572, miR-130a-3p and miR-19b-3p (see Additional file 6). [score:1]
High values for sensitivity, specificity and the area under the curve (AUC) were observed for five miRNAs: miR-181b-5p, miR-320a, miR-572, miR-130a-3p and miR-19b-3p (see Additional file 6). [score:1]
[1 to 20 of 12 sentences]
21
[+] score: 44
In light of this, we presume that miR-181 upregulation is an important host protective mechanism against endotoxin shock, because it can shift the immune status from hyperinflammation to endotoxin tolerance via a rapid shutdown of inflammatory cytokine expression without altering anti-inflammatory cytokine expression. [score:8]
The miR-181 mimics also suppressed ouabain -induced TNF-α mRNA expression in A549 cells (Fig 3D) and TNF-α protein expression in human blood monocytes (Supplementary Fig S8A), miR-181d had the strongest effect. [score:7]
Q-PCR analysis showed that miR-181b, miR-181c, and miR-181d were upregulated in sepsis patients, while miR-181a and miR-16 were unchanged (Fig 4E). [score:4]
Luciferase constructs with mutations in T55 were designated m1, m2, m3, m4, m5, m6, m7, FM (full mutation), and 181BSM (miR181 binding site mutation), respectively. [score:4]
To verify database predictions, we showed that “mimics” of miR-181a, miR-181b, miR-181c, and miR-181d inhibited the luciferase activity of a TNF-α 3′-UTR reporter (T789), but had no effect when the miR-181 binding site was mutated (T789 m) (Fig 3C, left panel). [score:3]
Notably, miR-181d failed to alter the general ribosome profile and TNF-α mRNA distribution in polysomes (Supplementary Fig S9A–D), indicating that members of the miR-181 family specifically regulate TNF-α mRNA stability. [score:2]
A mutated version (T789 m) of this construct carrying a 7-bp substitution in the miR-181 binding site was obtained through site-directed mutagenesis. [score:2]
Therefore, we compared the expression of the miR-181 family members in human monocytes isolated from 25 patients with severe sepsis due to infections. [score:2]
In ouabain -treated cells, TNF-α mRNA stability was preferentially regulated by HuR and not by miR-181 family members. [score:2]
Thus, the AREs and the miR-181 binding site within the TNF-α 3′-UTR are cis-regulatory elements that are functionally dependent on each other. [score:2]
The microRNA181 family consists of four members: miR-181a, miR-181b, miR-181c, and miR-181d. [score:1]
The microRNA181 family negatively regulates TNF-α mRNA stability and induces immunoparalysis. [score:1]
In fact, only one miR-181 binding site is present in the minimal TNF-α 3′-UTR (T55); in contrast, seven “AUUUA” motifs are located in the immediate vicinity of the miR-181 binding site. [score:1]
Notably, miR-181 binding sites are frequently distributed in the 3′-UTRs of many inflammatory cytokines, including IL-1α and TNF-α; surprisingly, no miR-181 binding sites have been found in the 3′-UTRs of anti-inflammatory cytokines such as IL-10 and TGF-β. [score:1]
Here, we showed that members of the miR-181 family act downstream of TLR4 signaling to induce TNF-α mRNA degradation. [score:1]
Therefore, it is likely that the binding of HuR to the 3′-UTR of TNF-α triggers a conformational change in the local RNA that masks the miR-181 binding site. [score:1]
Because the miR-181 binding site in the 3′-UTR of TNF-α is located within two adjacent “AUUUA” motifs (Supplementary Fig S14A), we speculated that, after ouabain treatment, HuR might counteract the destabilizing effect of miR-181d on TNF-α mRNA. [score:1]
Luciferase activity in A549 cells transfected with constructs encoding vector T789-Luc or T789 m-Luc of TNF-α 3′-UTR plus mimics of miR-181a, miR-181b, miR-181c, miR-181d (left panel), or antagomir-181 (right panel). [score:1]
[1 to 20 of 18 sentences]
22
[+] score: 44
Similar to miRNA deregulation in AD, human lymphoblastoid cells up-regulate miR-34a and down-regulate miR-210 following arsenic treatment, as well as up-regulate miR-125b, -130, -145 and miR-181b under conditions of folate deficiency [187]. [score:11]
In this respect, there is a long list of predicted miRNAs (i. e. from DIANA-microT, miRanda, TargetScanS algorithms) that may target the 3'UTR of APP, including let-7i, miR-15, -26, -29, -93, -101, -106, and miR-181 which are reportedly down-regulated in AD brain [96, 99]. [score:8]
For example, the up-regulation of miR-181b in schizophrenia, or let-7 and miR-125b in DS, are also observed in sporadic AD and may denote common mechanisms of disease (Table 1B). [score:6]
In our studies on miRNA and gene expression in AD PBMC, we observed impaired DNA repair and antioxidant gene responses, which correlate with the up-regulation of miR-181b, -200a, -517* and miR-520h, and may possibly repress DNA repair and oxidative stress response mechanisms [39]. [score:6]
Interestingly, miR-181b is up-regulated in schizophrenia-affected brains where mitochondrial dysfunction has been documented [190], and may warrant further investigation in AD brain in light of its up-regulation in AD PBMC. [score:5]
For example, the up-regulation of peripheral miRNAs in AD could contribute to the diminished plasma proteins reported to be predictive biomarkers for AD [168], such as chemokine-7 (let-7f, miR-181b) and interleukin-1α (miR-181b, -200a). [score:4]
For example, we found more robust up-regulation of miR-181b and miR-371 in Alzheimer PBMC relative to control subjects in the APOEε4 -positive stratum [39]. [score:4]
[1 to 20 of 7 sentences]
23
[+] score: 42
To determine whether decreased miR-21 and miR-181b expression in S100A9 knockout mice during late sepsis is due to lack of C/EBPβ expression and/or Stat3 phosphorylation, we examined C/EBPβ and phosphorylated Stat3 protein levels in the Gr1 [+]CD11b [+] cell lysates. [score:6]
Mechanistically, our data support that nuclear S100A9 promotes the expression of known immunosuppressive miR-21 and miR-181b (24). [score:5]
However, the mechanistic link between miR-21 and miR-181b expression, as well as the signaling regulatory path involving C/EBPβ and NFI-A, supports that S100A9 acts as a transcription co-factor or an indirect epigenetic mediator. [score:5]
Figure 8The expression of miR-21 and miR-181b in Gr1 [+]CD11b [+] cells is inhibited during late sepsis. [score:5]
Expression of miR-21 and miR-181b is induced in Gr1 [+]CD11b [+] cells during sepsis and promotes Gr1 [+]CD11b [+] cell expansion (24). [score:3]
These results strongly support that S100A9 sustains both NFI-A and miR-21 and miR-181b levels during late sepsis immunosuppression. [score:3]
Quantitative real-time qPCR was used to determine the expression levels of S100A8, S100A9, miR-21, and miR-181b in Gr1 [+]CD11b [+] cells. [score:3]
MDSCs Lacking S100A9 Do Not Express miR-21 and miR-181b during Late Sepsis. [score:3]
We also reported that NFI-A expression is induced downstream of miR-21 and miR-181b and promotes Gr1 [+]CD11b [+] cell expansion during sepsis by attenuating myeloid cell differentiation and maturation (31). [score:3]
We previously reported that miR-21 and miR-181b induction during sepsis is dependent on both C/EBPβ expression and Stat3 phosphorylation, which synergize to activate miR-21 and miR-181b promoters (37). [score:3]
Levels of miR-21 and miR-181b in Gr1 [+]CD11b [+] cells were increased during early sepsis in both wild-type and knockout mice (Figure 8A). [score:2]
We reported that blocking miR-21 and miR-181b in septic mice by administration of miRNA antagomiRs diminishes Gr1 [+]CD11b [+] MDSC expansion during late sepsis response (24). [score:1]
[1 to 20 of 12 sentences]
24
[+] score: 42
miR-181, miR-183 and miR-200 miRNAs Families Members are Similarly down-regulated during in vitro DecidualizationInterestingly, three miRNAs families (miR-181, miR-183 and miR-200) were down-regulated during the decidualization process. [score:7]
Noteworthily, some of the differentially expressed miRNAs identified in our study during decidualization have been found to be misregulated in endometriosis (e. g., miR-9, miR-135b and miR-141) [56], [17], [43], preeclampsia (e. g., miR-155, miR-183 and miR-181b) [18], [19], [57] or endometrial cancer (e. g., the miR-200 family and miR-96) [54], [58], [59]. [score:4]
miR-181, miR-183 and miR-200 miRNAs Families Members are Similarly down-regulated during in vitro Decidualization. [score:4]
The molecular pathways potentially regulated by the mir-181, miR-200 and miR-183 families with the potential target genes are listed below the histograms. [score:4]
Interestingly, three miRNAs families (miR-181, miR-183 and miR-200) were down-regulated during the decidualization process. [score:4]
For the mir-181 family, which includes six miRNAs precursors (mir-181a-1, mir-181a-2, mir-181b-1, mir-181b-2, mir-181c and mir-181d) located at three different loci (chromosomes 1, 9 and 19), the corresponding mature miRNA expression in decidual cells decreased (Figure 1B). [score:3]
Surprisingly, from the total 33 differentially expressed miRNAs during our in vitro decidualization mo del, only two (miR-181b and miR-181d) have been previously identified in the Qian et al study [22]. [score:3]
One validated target of miR-181b in mice is TIMP-3, an inhibitor of metalloproteases and a characteristic decidualization marker [49]. [score:3]
By using the Diana miR-Path database [21], we searched for the molecular pathways potentially regulated by the mir-181 family. [score:2]
The top two molecular pathways potentially regulated by the miR-181 family are TGFß signaling and T cell receptor. [score:2]
Another interesting finding is that all the members of three different miRNAs families (miR-181, miR-200 and miR-183) have been identified to be similarly regulated. [score:2]
B, miR-181 C, miR-200 and D, miR-183 family members’ expression in the E+P decidualized hESCs for 9 days if compared to the non decidualized control hESCs. [score:2]
miR-181, miR-183 and miR-200 miRNAs families members are similarly regulated during in vitro decidualization. [score:2]
[1 to 20 of 13 sentences]
25
[+] score: 41
In this study, we report that lncRNA by competitively binding the miR-181 family, upregulating Bcl-2, and then suppressing gastric carcinogenesis (Fig.   5d). [score:6]
Furthermore, ectopic expression of MEG3 in HGC-27 and MGC-803 cells inhibited cell proliferation, migration, invasion, and promoted cell apoptosis, which might be due to MEG3 sequestering oncogenic miR-181 s in GC cells. [score:5]
Furthermore, MEG3 affected GC cell phenotypes in a miR-181 sites -dependent manner, which occurs without changes in the levels of miR-181 isoforms, suggesting that MEG3 regulates miR-181 activity by altering miRNA targeting. [score:4]
These findings suggest that lncRNA MEG3, a ceRNA of miR-181 s, could regulate gastric carcinogenesis and may serve as a potential target for antineoplastic therapies. [score:4]
We also showed that MEG3 inhibited GC cell proliferation, migration and invasion by operating as a competing endogenous RNA (ceRNA) for the miR-181 microRNA (miRNA) family. [score:3]
b The expression of MEG3 and Bcl-2 mRNA in HGC-27 cells transfected with empty vector, wild type MEG3 or mutant MEG3 as indicated; c Immunoblot analysis of Bcl-2 protein in HGC-27 cells transfected with empty vector, wild type MEG3 or mutant MEG3 as described in B; d A Schematic mo del of MEG3/miR-181/Bcl-2 cascade in gastric carcinogenesis. [score:3]
Taken together, our research demonstrated that MEG3 acted as a key regulator in human gastric carcinogenesis and revealed roles of MEG3 in regulating miR-181-Bcl2 axis. [score:3]
Studies have reported that miR-181 targets multiple Bcl-2 family members in astrocytes [24]. [score:3]
Subsequently, we constructed a series of luciferase reporters containing the wild type MEG3 (pMIR-MEG3-WT), or mutant MEG3 with mutations of single (pMIR-MEG3-MUT1, 2, 3, 4) or all four predicted miR-181 binding sites (pMIR-MEG3-MUT1-4). [score:2]
The miR-181 family contains four miRNAs (miR-181a/b/c/d), which are transcribed from three separated gene loci. [score:1]
The lower panel: the prediction for miR-181 s binding sites on MEG3 transcript. [score:1]
MEG3 is physically associated with miR-181 family. [score:1]
Among the results, we found 4 miR-181 family binding sites scattering the MEG3 transcripts, suggesting its ceRNA potential for miR-181 s (Fig.   3a). [score:1]
Fig. 3The interaction of MEG3 with miR-181. [score:1]
We found that transfection of HGC-27 cells with miR-181a mimic reduced the luciferase activities of the MEG3-WT reporter vector but not empty vector or all miR-181 site mutant reporter vector (Fig.   3b), suggesting the binding of miR-181a to these sites. [score:1]
a The upper panel: schematic outlining the predicted binding sites of miR-181 s on MEG3. [score:1]
The red nucleotides are the complementary sequences to miR-181 seed sequences. [score:1]
[1 to 20 of 17 sentences]
26
[+] score: 41
Of the predicted hundreds of targets for any specific miRNA, a range of 10 to 30 downregulated transcripts in Alzheimer BMC were correlated, however only transcripts with significantly lower levels in AD are reported in Table 3. The percentage of targets per miRNA is reported in Table 1. Interestingly, miR-181b, which exhibited the greatest fold-increase expression in Alzheimer BMC, targeted the highest proportion of downregulated genes in AD BMC (31.1%), followed by miR-34a (21.7%). [score:15]
The enriched GO categories for the downregulated targets identified for some of the individual upregulated miRNAs were as follows: Cell Homeostasis and Peroxisome for miR-34a; Cell Cycle and DNA Damage for miR-181b; and Vesicle Processes for miR-517*. [score:9]
Target genes with significantly downregulated transcript levels in AD frequently correlated with miR-181b (NDUFS3, HSF2), let-7f (HERPUD1, TBPL1) and miR-34a (HNRPR, BTF3). [score:6]
Similarly to the entire cohort, we found common miRNA upregulated in AD, with tendencies for over-representation of certain miRNA in the APOE4 -negative (i. e. miR-34a, 517*, let-7f, 200a), and possibly the APOE4 -positive (i. e. miR-371; miR-181b) strata. [score:4]
A higher upregulation of miR-181b in Alzheimer BMC may also occur in APOE4 -positive AD subjects. [score:4]
Importantly, Cell Cycle and DNA Damage related GO categories are targeted by miR-181b, 200a, and 517*. [score:3]
[1 to 20 of 6 sentences]
27
[+] score: 37
We found that hsa-miR-181b functions as a tumor suppressor and overexpression inhibited growth and induced apoptosis. [score:7]
For instance, several brain-enriched miRNAs, miR-128, miR-181a, miR-181b, and miR-181c, are mainly down-regulated in glioblastomas [7], whereas miR-221 and miR-21 are strongly up-regulated in GBM and grade II–IV astrocytic tumors [8]. [score:7]
Similar results have been found previously, as hsa-miR-181a and especially hsa-miR-181b mature miRNAs have been shown to be expressed at low levels in GBM and miR-181b in astrocytomas compared to the normal brain [8], [22] as well as function as tumor suppressors and inhibit invasion of glioma cells [23]. [score:6]
miRNA Expressionp-value Expression fold change (log2) Survivalp-value hsa-miR-136 7.52E-14 −1.69 NS hsa-miR-145 5.88E-04 −1.04 0.005 hsa-miR-155 1.18E-21 1.94 NS hsa-miR-181b 5.44E-02 −0.22 NS hsa-miR-342 4.35E-10 −1.25 NS hsa-miR-129 1.29E-16 −3.39 NS hsa-miR-376a 4.35E-07 −0.63 NS hsa-miR-376b 7.37E-02 0.07 NS Survival p-value was calculated from miRNA expression data with Kaplan-Meier analysis. [score:5]
Generally, microRNAs are mainly down-regulated in cancers, as is the case with miR-128, miR-181a, miR-181b, and miR-181c in glioblastomas [7]. [score:4]
In addition, low miR-181b expression levels have been found to correlate with poor survival in patients with astrocytomas compared to patients with high miR-181b expression levels (p-value<0.039, [22]). [score:4]
Six miRNAs (miR-181b, -432, -136, -145, -342, -9) cluster clearly separately based on the stronger effect on proliferation of the precursor miRNAs and are underexpressed in the A172 cell line compared to the normal brain (Figure 1B). [score:2]
These findings are in line with our findings for miR-181b. [score:1]
This survival effect for miR-181b was not seen in the TCGA GBM cohort. [score:1]
[1 to 20 of 9 sentences]
28
[+] score: 30
Tumor suppressor miRNAs (miR-15b, miR-16, miR-34, miR-181b, miR-181c, and miR-497) target anti-apoptotic Bcl-2. These miRNA clusters are downregulated in gastric cancer cells, leading to increased expression of Bcl-2 and inhibition of apoptosis. [score:12]
Furthermore, overexpression of miR-181b downregulated the protein levels of tissue inhibitor of metalloproteinase 3 (TIMP). [score:8]
The upregulation of miR-181b may play an important role in the progression of gastric cancer and miR-181b may be a potential molecular target for gastric cancer therapies. [score:6]
miR-181b is aberrantly overexpressed in H. pylori infection and gastric cancer tissues [20]. [score:3]
Cell proliferation, migration, and invasion in the gastric cancer cells were significantly increased after miR-181b transfection, and the number of apoptotic cells was also increased. [score:1]
[1 to 20 of 5 sentences]
29
[+] score: 28
The miR-181 family is particularly enriched in the brain and is involved in autism spectrum disorders [56], schizophrenia [57], Alzheimer disease [58], where they are mainly found to be upregulated. [score:6]
Note that prenatal stress downregulated miR-181 and miR-186 expression in the frontal cortex. [score:6]
Downregulation of miR-181 contributes to accelerated HIV -associated dementia in opiate abusers [59]. [score:4]
Behavioural findings in stressed dams were accompanied by altered epigenetic profiles in the frontal cortex, including downregulation of miR-181b. [score:4]
Downregulation of miR-181 was shown to have protective effects against apoptosis and mitochondrial dysfunction [60]. [score:4]
At the cellular level, miR-181 regulates apoptosis factors such as bcl-2 in astrocytes. [score:2]
miR-181 and miR-186 were chosen for verification using qRT-PCR analysis. [score:1]
Stress also led to critical decreases in let-7c, miR-23b, miR-181, and miR186 amounts. [score:1]
[1 to 20 of 8 sentences]
30
[+] score: 27
This miRNA regulates the expression of the cell cycle regulator p27 [kip1], which is normally induced during monocytic differentiation, thus ectopic expression of miR-181 counteracts monocytopoiesis [54]. [score:7]
Increased expression levels of miR-181 were associated with favourable outcome in AML with both normal and abnormal karyotypes [75, 104, 105], and connected with CEBPA mutations [105]. [score:4]
In this case, the downregulation of the miR-181 family was suggested to contribute to an aggressive leukemia phenotype through mechanisms associated with the toll-like receptors and interleukin-1 β  [73]. [score:4]
Among the deregulated miRNAs in AML, these studies identified miRNAs already known to be hematopoietic specific (e. g., miR-142-5p, miR-223, and miR-181) or reported to be highly expressed in other hematological malignancies and solid tumours (e. g., miR-221, miR-222, miR-17-92 cluster and miR-155) [6, 18, 20, 21, 69]. [score:4]
In particular, these studies identified miR15/miR-16, miR-26, miR-29, miR-107, miR-142, miR-342, and let7 between the miRNAs significantly induced, whereas miR-181b was found to be downregulated by ATRA. [score:4]
Conversely, miR-181 levels are decreased by VitD3 treatment [54]. [score:1]
In contrast, in different studies performed on a high-risk subgroup with normal karyotype, decreased levels of miR-181 were identified [73]. [score:1]
Microarray analysis identified different miRNAs modulated during monocytic differentiation of AML cell lines, in particular miR-424, miR-32, and miR-181 [49– 51]. [score:1]
Increased miR-181 levels characterized these leukemias [71], a miRNA known to be involved in lymphoid lineage differentiation and to inhibit monocytopoiesis [18, 54]. [score:1]
[1 to 20 of 9 sentences]
31
[+] score: 27
The sequences for control and miR-181a inhibitors were as follows: control inhibitor, 5′-CAGUACUUUUGUAGUACAA-3′ and miR-181 inhibitor, 5′-ACUCACCGACAGCGUUGAAUGUU-3′. [score:7]
MiR-181a down-regulates triglycerides and total cholesterol levels in vivoWe have recently characterized the inhibitory function of miR-181 in the regulation of embryo implantation in mice (unpublished data). [score:5]
The findings that IDH1 is a direct target of miR-181 and the opposite phenotypes displayed by miR-181a TG and IDH1 TG mice led us to test the possibility that miR-181a may regulate lipid metabolism through IDH1. [score:5]
To knockdown miR-181a in mice, six-week old miR-181 WT male mice were given administration of nanoparticles packed with either control or miR-181a inhibitors four times at one-week intervals 33. [score:4]
To determine whether miR-181a is involved in the regulation of lipid metabolism, six-week old miR-181 TG and WT male mice were fed with high fat diet (HFD) for 10 weeks. [score:2]
To explore whether miR-181a is involved in the regulation of lipid metabolism, both miR-181 TG and WT mice were fed with high fat diet (HFD), and after 10 weeks of feeding, miR-181a TG mice exhibited smaller size and lower body weight than miR-181a WT mice (Figures 1A and 1B) while these mice showed no obvious differences in food intake (Supplementary Figure S1B). [score:2]
We have recently characterized the inhibitory function of miR-181 in the regulation of embryo implantation in mice (unpublished data). [score:2]
[1 to 20 of 7 sentences]
32
[+] score: 24
The miRNAs expressed at the highest levels coincided with those reported by previous studies, and were similar to those expressed by NBC in our study, though several divergences emerged between CLL and NBC, such as the previously reported overexpression of miR-150-5p, miR-29a-3p, miR-155-5p, or miR-101-3p, underexpression of miR-181a-5p, or miR-181b-5p [14– 19], and others not firmly established yet, including the highly divergent miR-451a, miR-28-5p, miR-144-5p, miR-486-5p, or miR-486-3p, within the overexpressed, and miR-126-3p, miR-365a-3p, miR-199a-3p, or miR-582-5p, within the underexpressed. [score:13]
However, 41 miRNAs were differentially expressed between CLL and NBC according to the Student t test (cut-off 2-fold, p<0.05), being 29 overexpressed in CLL, including miR-150-5p, miR-29a-3p, miR-29b-3p, let-7a-5p, miR-26a-5p, miR-451a, miR-155-5p, miR-101-3p, miR-28-5p, miR-144-5p, miR-486-5p, or miR-486-3p, and 12 underexpressed, including miR-181a-5p, miR-222-3p, miR-126-3p, miR-365a-3p, miR-181b-5p, miR-199a-3p, or miR-582-5p (Table 1). [score:7]
In CLL, several miRNAs have been recurrently found overexpressed compared to normal B cells (NBC), such as miR-155 [14– 19], miR-150 [14, 16, 19], miR-101 [14, 18, 19], miR-21 [14, 18], miR-29a [18, 19], or miR-29c [16, 19], or underexpressed, such as miR-181a, miR-181b [15, 18, 19], and miR-223 [15, 16, 19]. [score:4]
[1 to 20 of 3 sentences]
33
[+] score: 23
Specifically, miR181-a is present in both bovine oocytes and embryos with increased expression in early stages of development then drops to low levels in the blastocyst and is thought to regulate nucleoplasmin2 a protein important in nuclear organization (Lingenfelter et al., 2011). [score:5]
Activin and TGF beta regulate expression of the microRNA-181 family to promote cell migration and invasion in breast cancer cells. [score:4]
Cutting edge: microRNA-181 promotes human NK Cell development by regulating notch signaling. [score:3]
MiR-181 and miR-370 were found to be expressed in the control media regardless of BSA supplementation (Table 3). [score:3]
When BSA was not supplemented in SOF media, miR-181 showed expression though right at threshold cut off in one blastocyst pool and was not detected in the second pool making the data not conclusive. [score:3]
In BSA supplemented media, the expression of both miR-181 and miR-370 was detected though not statistically significantly different between embryos of varying quality or above the baseline control. [score:3]
MiR-181 has been associated with roles in genes relating to cancer (Neel and Lebrun, 2013), immune function through NK cell development (Cichocki et al., 2011) and embryonic development (Lingenfelter et al., 2011). [score:2]
[1 to 20 of 7 sentences]
34
[+] score: 22
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-181a-2, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-140, hsa-mir-125b-2, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-206, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-302a, hsa-mir-34b, hsa-mir-34c, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-125b-2, gga-mir-155, gga-mir-222a, gga-mir-221, gga-mir-92-1, gga-mir-19b, gga-mir-20a, gga-mir-19a, gga-mir-18a, gga-mir-17, gga-mir-16-1, gga-mir-15a, gga-mir-1a-2, gga-mir-206, gga-mir-223, gga-mir-106, gga-mir-302a, gga-mir-181a-1, gga-mir-181b-1, gga-mir-16-2, gga-mir-15b, gga-mir-140, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-146a, gga-mir-181b-2, gga-mir-181a-2, gga-mir-1a-1, gga-mir-1b, gga-let-7a-2, gga-mir-34b, gga-mir-34c, gga-let-7j, gga-let-7k, gga-mir-23b, gga-mir-27b, gga-mir-24, gga-mir-122-1, gga-mir-122-2, hsa-mir-429, hsa-mir-449a, hsa-mir-146b, hsa-mir-507, hsa-mir-455, hsa-mir-92b, hsa-mir-449b, gga-mir-146b, gga-mir-302b, gga-mir-302c, gga-mir-302d, gga-mir-455, gga-mir-367, gga-mir-429, gga-mir-449a, hsa-mir-449c, gga-mir-21, gga-mir-1458, gga-mir-1576, gga-mir-1612, gga-mir-1636, gga-mir-449c, gga-mir-1711, gga-mir-1729, gga-mir-1798, gga-mir-122b, gga-mir-1811, gga-mir-146c, gga-mir-15c, gga-mir-449b, gga-mir-222b, gga-mir-92-2, gga-mir-125b-1, gga-mir-449d, gga-let-7l-1, gga-let-7l-2, gga-mir-122b-1, gga-mir-122b-2
Clusters mir-16-1-mir-15a, let-7f-let-7a-1, mir-181a-1-mir-181b-1, let-7j-let-7k, mir-23b-mir-27b-mir-24, and mir-16-2-mir-15b were down-regulated in lungs and mir-181a-1-mir-181b-1 was also down-regulated in tracheae with AIV infection. [score:7]
Only miR-181b was expressed in the macrophage cell line HD11 as well in the spleen adherent cells and that its expression increased after activation by LPS or CD40-ligand [42]. [score:5]
The mir-181a-1-mir181b-1 cluster was significantly down-regulated in both infected lungs and tracheae. [score:4]
These results suggest that miR-181a and miR-181b may be strong miRNA candidates that regulate host response to AIV infection, and warrant further investigation of their targets and regulation mechanism in chickens. [score:3]
In the current study, miR-181b had same expression pattern with miR-181a in both lung and trachea comparisons. [score:3]
[1 to 20 of 5 sentences]
35
[+] score: 22
Ciafrè et al. [54] demonstrated aberrant expression profiles of numerous miRNAs such as miR-221 which were strongly upregulated in GBM and miRNAs such as miR-128, miR-181a, miR-181b, and miR-181c which were shown to be downregulated in GBM. [score:9]
Increased tumor initiating cell properties were attributed to upregulated expression of neurooncological ventral antigen 1 (NOVA 1) that is normally regulated by miR-181b-5p [180], further emphasizing the role of targeting BTICs for complete eradication of cancer. [score:9]
A study by Zhi et al. in 2014 demonstrated the association of miR-181b-5p downregulation with poor prognosis [180]. [score:4]
[1 to 20 of 3 sentences]
36
[+] score: 21
While no functional consequence of the downregulation of miR-181b or d could be identified [38], the reduced expression of miR-142-3p was reported to allow increased Adenylyl Cyclase 9 activity and thus increase cAMP levels in murine Tregs [44]. [score:6]
Together, these results demonstrate that a 400-bp region of the GARP 3’ UTR, that is directly targeted by miR-142-3p, miR-185 and the four miR-181, controls GARP protein levels and the amounts of TGF-β1 that are processed and secreted by human CD4 [+] T cells. [score:4]
Mutation of the miR-142-3p binding site, but not that of the miR-181 site, suppressed the ability of the miR-142-3p mimic to decrease reporter activity in 293 cells (Figure 6D). [score:4]
Conversely, mutation of the miR-181 site, but not that of the miR-142-3p site, suppressed the ability of the four m iR-181 family members to decrease reporter activity (Figure 6D). [score:4]
Others have reported a reduced expression of miR-142-3p and miR-181 b and d in murine or human Tregs by comparison to Th cells [37, 38, 44, 46]. [score:3]
[1 to 20 of 5 sentences]
37
[+] score: 21
Targets for miR-181b include heat shock protein A5 (HSPA5) and ubiquitin carboxyl-terminal hydrolase isozyme L1 (UCHL1), and expression of miR-181b in N2A cells repressed HSPA5 and UCHL1 and protected cells against OGD -induced cell death. [score:5]
Responses to ischemia in mouse brain also showed increased expression of miR-181 in the core, where cells die, and decreased expression of miR-181 in the penumbra, where cells survive (69). [score:5]
miR-181b andThe expression of miR-181b and is decreased by HPC and ischemia in adult mouse cortex, but increased in tolerant brain (90). [score:3]
by manipulation of miRNA-related pathways are also found in astrocyte-rich miRNAs, including miR-181 and families, and miR-146a, and their validated targets, GRP78, and Bcl-2 family members (114). [score:3]
The expression of miR-181b and is decreased by HPC and ischemia in adult mouse cortex, but increased in tolerant brain (90). [score:3]
Further, miR-181b antagomirs reduced caspase-3 cleavage and neuronal cell loss in ischemic cortex and improved neurological deficits in mice after ischemia (104). [score:1]
miR-181b and miR-134. [score:1]
[1 to 20 of 7 sentences]
38
[+] score: 20
A validated target gene of miR-181b is TIMP3, tissue inhibitor of metalloproteinases-3, which is a tumor suppressor gene that has been reported as down-regulated in EAC [22]. [score:10]
Up-regulation of miR-181b leads to lower expression of TIMP3 [23], which indicates that miR-181b has an oncogenic function. [score:6]
One example is miR-181b, which in the present study was shown for the first time to be up-regulated (fold change 4.11) in EAC. [score:4]
[1 to 20 of 3 sentences]
39
[+] score: 20
hESC were transfected with a miR-181a inhibitor or a miRNA inhibitor negative control (miRNA inhibitor control, 100 nM) for 24 h, and then cells were treated with or without 0.5 mM 8-Br-cAMP and 1 μM MPA (8Br + MPA) for an additional 72 h. miR-181 family (A), FOXO1A (B), PRL (C), IGFBP1 (D), DCN (E), and TIMP3 (F) mRNA expression levels were examined by qRT-PCR. [score:9]
miR-181a inhibitor specifically suppressed endogenous miR-181a expression without affecting miR-181b, miR-181c, or miR-181d levels in hESC (Figure  2A). [score:7]
Various potential miR-181 family targets, such as ETS1, CREB1/3, Esr1, and PGR, are involved during differentiation and decidualization events [16- 18]. [score:3]
MicroRNA-181a (miR-181a), which belongs to the miR-181 family, is a key modulator of cellular differentiation. [score:1]
[1 to 20 of 4 sentences]
40
[+] score: 20
Auxiliary pairing regulates miRNA–target specificity in vivoAs a striking indication that auxiliary pairing regulates miRNA–target specificity, duplex structure analysis revealed distinct binding patterns for members of miRNA seed families (for example, let-7, miR-30, miR-181 and miR-125) (Fig. 4d). [score:7]
identified functional, non-canonical regulation globally for miR-128 and miR-124 (Fig. 2), and for individual miR-9, miR-181, miR-30 and miR-125 targets (Fig. 4f and Fig. 8b–m). [score:4]
As a striking indication that auxiliary pairing regulates miRNA–target specificity, duplex structure analysis revealed distinct binding patterns for members of miRNA seed families (for example, let-7, miR-30, miR-181 and miR-125) (Fig. 4d). [score:4]
Analysis of miR-125 and miR-181 families revealed additional intra -family target preferences (Supplementary Fig. 9a–d). [score:3]
Similarly, miR-181 family members were enriched in both seed -dependent and -independent classes. [score:1]
Interestingly, a number of major miRNAs enriched for seedless interactions (for example, miR-9, miR-181, miR-30 and miR-186) have AU-rich seed sites, indicating that weak seed-pairing stability may favour seedless non-canonical interactions 10. [score:1]
[1 to 20 of 6 sentences]
41
[+] score: 19
By applying a combination of various prediction algorithms, we identified the 3′-UTR of c-FOS as a potential target for miR-181a and miR-181b (down-regulated the in EBV -associated lymphomas), CD44 as a potential target of miR-20a and miR-106a, and the IL1R1 as a target of miR-205 and -125a. [score:10]
We further identified the 3′-UTR of the IL1A gene as a potential target for miR-142-3p, miR-181a and miR-181b which are repressed in EBV -associated lymphomas. [score:3]
When compared to primary thymus tissue, the tested miRNAs miR-142-3p, -145, -181b, -200c, -205 and –424 all were down-regulated in the tumor tissues and the cell lines tested, with the exception of miR-181b and miR-424 that essentially showed no change in the primary, frozen tissue of the NK/T-cell lymphoma. [score:3]
For the expression of miRNAs miR-125a, -181a, -181b, -106a, -106b, and 17, the following primer pairs were used: 5′miR-125a_EcoCGGAATTCTGGCTCTCAGAATGTCTC-3′, 3′miR-125a_Bam 5′-CGGGATCCGCCATCGTGTGGGTCTCAA-3′; 5′miR-181a-Bam 5′-GCGGATCCTGTGATGTGGAGGTTTGCC; 3′miR-181a-Bgl 5′-GCAGATCTAGTGAGCTTGTCCACACAG-3′; 5′miR-181b-Bam 5′-GCGGATCCCAACGCTGTCGGTGAGTT-3′, 3′miR-181b-Bgl 5′-CAGATCTGCATGGGTGCTGAGGTCCT; 5′miR-17Eco 5′-GGGAATTCCGTGTCTAAATGGACCTC-3′, 3′miR-17-Bam 5′-GGGATCCACAGCATTGCAACCGATCCCAA-3′; 5′miR-106a Eco 5′-GCGAATTCGCTTAGACTCTGTAAGCC-3′, 3′miR-106a-Bam 5′-GGGATCCTACGCTGAAATGCAAACCTGC-3′; 5′miR-106b Eco 5′-GCGAATTCTGGTAAGTGCCCAAATTGCTGG-3′; 3′miR-106b Bam 5′-GGATCCAGCACAGGATCTAGGACACATG-3′; 5′potmiR-27 Eco 5′-GCGAATTCTGGAGCTCATGAAGAGACCAAG-3′, 3′potmiR-27 Bgl 5′-GGAAGATCTAGGACAGTCTGTGTCCTCAG-3′; 5′potmiR-34 Eco 5′-GCGAATTCTGCTGTGTCAGAAAGGCTTCAC-3′, 3′potmiR-34 5′-GCGGATCCTGGGCATTCTTTCATCCCATC-3′; 5′ potmiR-42 Eco 5′-GCGAATTCGTCTGTATTCTCTTCTGGC-3′; 3′potmiR-42 Bam 5′-GGATCCCTGCTTTGAGAGTTCCTGAGT-3′. [score:2]
For the miRNAs shown in the diagram of Figure 1C, the level seen in thymus tissue was set to 1. The strongest relative induction was observed for miR-145 (11-fold), miR-143 (8-fold), and miR-125b (7-fold), while strongest reduction was determined for miR-20b (10-fold), miR-181b (8-fold), and miR-146a+b (5-fold). [score:1]
[1 to 20 of 5 sentences]
42
[+] score: 19
The downregulated miR-181b induces neuroprotection against ischemic injury through negatively regulating HSPA5 and UCHL1 protein levels, providing a potential therapeutic target for ischemic stroke 24. [score:7]
Six miRNAs (miRNA181-b, miRNA-181d, miRNA-605, has-let-7a, has-let-7b, and has-let-7f) were predicted to be related to stroke based on the targetgenes network (Fig. 5). [score:3]
ESM1, KRAS, miR-181d, miR-181b-3p, miR-605-3p and miR-605-5p were highly expressed in the blood of stroke patients compare to healthy people. [score:3]
The targetgenes of miR-181b, such as DDIT4 and Kank1, were also found to be related to stroke. [score:3]
Finally, ESM1, KRAS, miR-181d, miR-181b-3p, miR-605-3p and miR-605-5p were highly expressed in the blood of stroke patients compared to healthy people (Fig. 6). [score:2]
miR-181b, miR-181d and miR-605 are predicted based on the genes from miRanda database. [score:1]
[1 to 20 of 6 sentences]
43
[+] score: 19
MDM2 mRNA is upregulated in both GBM cell lines and samples [65], and the upregulation could be a consequence of the downregulation of miR-17-3p, miR-181b-5p, miR-25-3p or miR-32-5p, which directly target MDM2 gene expression [50, 65, 66]. [score:15]
In addition, miR-181b-5p is downregulated in GBM samples, further indicating that miRNA compromises contribute to the complexity of the pathological progression of gliomas [66]. [score:4]
[1 to 20 of 2 sentences]
44
[+] score: 19
We observed both miR-21 and miR-181b gene expression were dramatically reduced in RH30 and RH28 rhabdomyosarcoma cell lines by Bazedoxifene treatment (Fig 3D), which was consistent with the report that miR-21 expression was strongly suppressed by silence of STAT3 siRNA [41]. [score:7]
The expression of several known GP130/STAT3 downstream target genes and microRNA such as CYCLIN D1, SURVIVIN, and BCL-XL, miR-21, and miR-181b was reduced following Bazedoxifene treatment shown by RT-PCR or quantitative RT-PCR analysis, which also support the idea that Bazedoxifene is a potent inhibitor of GP130. [score:7]
D, miR21 and miR-181b gene expression were analyzed by real-time quantitative RT-PCR in RH30, or RH28 cells treated with Bazedoxifene overnight at the indicated concentration, **, P < 0.01; ***, P < 0.001. [score:3]
Mature microRNA-21 (miR-21) and microRNA-181b (miR-181b) gene expression were measured by quantitative reverse transcriptase (qRT-PCR) [37]. [score:1]
In addition, two STAT3 activation dependent microRNA-21(miR-21) and microRNA-181b (miR-181b), which were recently recognized oncogene implicated in multiple malignancy-related processes such as cell proliferation, anti-apoptosis, metastasis, and drug resistance [39, 40], were examined in RH30 and RH28 cells treated with Bazedoxifene using quantitative RT-PCR as described in Material and Method. [score:1]
[1 to 20 of 5 sentences]
45
[+] score: 19
Besides miRNA 181a, miR-220b, miR-513a-3p, miR-181b, miR-181c, miR-181d, miR-548n and miR-127-5p, are also predicted to target and regulate the expression of OPN. [score:6]
OA patients have higher expression of miR-220b, miR-513a-3p and miR-548n, but lower expression of miR-181a, miR-181b, miR-181c, miR-181d and miR-127-5p, compared to non-OA patients (Fig. 1A). [score:4]
As OPN increased in the pathogenesis of OA 32, we focused on the down-expressed miRNA, including miR-181a, miR-181b, miR-181c, miR-181d and miR-127-5p. [score:3]
This compelling study is indicating miR181 family members have critical importance in the establishment and development of OA. [score:2]
In total, eight potential regulatory miRNAs, including miR-220b, miR-513a-3p, miR-181a, miR-181b, miR-181c, miR-181d, miR-548n and miR-127-5p, were identified by the five algorithms. [score:2]
miR-miR181 family members have been reported to regulate the differentiation stages of chondrocyte and chondrocyte formation 40. [score:2]
[1 to 20 of 6 sentences]
46
[+] score: 18
Among of these miRNAs, mir-4521, mir-181b-5p, mir-100-5p and mir-3919 were significantly up-regulated, and mir-513a-5p was down-regulated. [score:7]
The results showed that mir-6739-5p, mir-4521, mir-181b-5p, mir-100-5p and hmir-3919 were up-regulated, while hsa-mir-513a-5p was down-regulated in arsenic -treated HaCaT cells (Figure 2C). [score:7]
The following forward primers were used: miRNA Sequence mir-181b-5p 5’-GCAACATTCATTGCTGTCGGTGGGT-3’ mir-100-5p 5’-GCGCAACCCGTAGATCCGAACTTGT-3’ mMir-6739-5p 5’-GCGCAGTGGGAAAGAGAAAGAACAAGT-3’ mir-4521 5’-GCGCTAAGGAAGTCCTGTGCTCAG-3’ mir-3919 5’-GGGCAGAGAACAAAGGACTCAGT-3’ mir-513a-5p 5’-GCGTTCACAGGGAGGTGTCAT-3’ U6 5’-ACACGCAAATTCGTGAAGCGTTCC-3’ To obtain a wide view of the potential miRNA targets, we performed an in silico prediction analysis using three distinct software: Miranda (www. [score:2]
The following forward primers were used: miRNA Sequence mir-181b-5p 5’-GCAACATTCATTGCTGTCGGTGGGT-3’ mir-100-5p 5’-GCGCAACCCGTAGATCCGAACTTGT-3’ mMir-6739-5p 5’-GCGCAGTGGGAAAGAGAAAGAACAAGT-3’ mir-4521 5’-GCGCTAAGGAAGTCCTGTGCTCAG-3’ mir-3919 5’-GGGCAGAGAACAAAGGACTCAGT-3’ mir-513a-5p 5’-GCGTTCACAGGGAGGTGTCAT-3’ U6 5’-ACACGCAAATTCGTGAAGCGTTCC-3’ To obtain a wide view of the potential miRNA targets, we performed an in silico prediction analysis using three distinct software: Miranda (www. [score:2]
[1 to 20 of 4 sentences]
47
[+] score: 18
miR-221 was strongly upregulated, whereas miR-128, miR-181a, miR-181b and miR-181c were downregulated in glioblastoma [29]. [score:7]
Pekarsky et al. discovered that the expression levels of miR-29 and miR-181 were inversely correlated with Tcl1 expression in CLL. [score:5]
Their results showed that miR-29 and miR-181 might be candidates for therapeutic agents in CLL overexpressing Tcl1 [30]. [score:3]
Analyzing the genome-wide miRNA expression profile in human PTCs using microarray, Pallante et al. detected a significant increase of miR-181b, miR-221 and miR-222 in the comparison of PTCs with normal thyroid tissue. [score:3]
[1 to 20 of 4 sentences]
48
[+] score: 18
During myogenesis it is up-regulated by SRFs and MEF2, and in a self-regulatory manner, it suppresses YY1 and HDAC4 translation by targeting their 3′-UTRs [48, 49]; miR-146a is another positive regulator of myogenesis, since it modulates the activity of NUMB protein, which promotes satellite cell differentiation towards muscle cells by inhibiting Notch signaling [55, 56]; miR-181 is involved in skeletal muscle differentiation and regeneration after injury and one of its targets is Hox-A11, which in turn represses transcription of MyoD [54]; miR-214 was identified in zebrafish as regulating the muscle development. [score:18]
[1 to 20 of 1 sentences]
49
[+] score: 18
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-139, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-190a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-429, hsa-mir-491, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, hsa-mir-517a, hsa-mir-500a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-637, hsa-mir-151b, hsa-mir-298, hsa-mir-190b, hsa-mir-374b, hsa-mir-500b, hsa-mir-374c, hsa-mir-219b, hsa-mir-203b
Polycyclic aromatic hydrocarbon (PAH) -mediated upregulation of hepatic microRNA-181 family promotes cancer cell migration by targeting MAPK phosphatase-5, regulating the activation of p38 MAPK. [score:7]
TGFbeta -mediated upregulation of hepatic miR-181b promotes hepatocarcinogenesis by targeting TIMP3. [score:6]
Zhang and Pan (2009) have evaluated the effects of Hexahydro-1, 3, 5-trinitro-1, 3, 5-triazine (also known as hexogen or cyclonite) (RDX) on miRNA expression in mouse brain and liver, most of the miRNAs that showed altered expression, including let-7, miR-17-92, miR-10b, miR-15, miR-16, miR-26, and miR-181, were related to toxicant-metabolizing enzymes, and genes related to carcinogenesis, and neurotoxicity, in addition, consistent with the known neurotoxic effects of RDX, the authors documented significant changes in miRNA expression in the brains of RDX -treated animals, such as miR-206, miR-30a, miR-30c, miR-30d, and miR-195. [score:5]
[1 to 20 of 3 sentences]
50
[+] score: 18
For example, miR-181 and miR-153 promote apoptosis by directly targeting B-cell chronic lymphocytic leukemia/lymphoma 2 (Bcl-2) mRNA and repressing its translation, thereby inhibiting gliomagenesis [84]. [score:8]
Moreover, miR-181 downregulation is more prominent in grade III and IV glioma than that in lower grades [84, 87]. [score:4]
Both miR-181 and miR-153 expression is decreased in glioma cell lines and a subset of clinical glioma specimens, suggesting roles of the two miRNAs in glioma progression. [score:3]
Shi L. Cheng Z. Zhang J. Li R. Zhao P. Fu Z. You Y. hsa-mir-181a and hsa-mir-181b function as tumor suppressors in human glioma cells Brain Res. [score:3]
[1 to 20 of 4 sentences]
51
[+] score: 18
Since we have previously shown that HMGA1 is able to negatively regulate CBX7 expression (Mansueto et al., 2010) and that HMGA1 positively regulates miR-181 that has CBX7 as target, we can envisage a HMGA1-CBX7 network that operates in the regulation of tumour progression and adipocyte cell growth and differentiation. [score:8]
Identification of a new pathway for tumor progression: microRNA-181b up-regulation and CBX7 down-regulation by HMGA1 protein. [score:7]
Interestingly, a drastic increase in miR-181b expression has been observed in 3T3-L1 cells after induction of adipocyte differentiation (R. F., personal communication). [score:3]
[1 to 20 of 3 sentences]
52
[+] score: 17
In order to mitigate the observed off- target transgene expression in ganglion cells following intravitreal delivery of hGRK1-containing AAV vectors, we incorporated a target sequence for miR181, an miRNA shown to be expressed exclusively in ganglion cells and inner retina into our AAV vectors (Atlas of miRNA distribution: http://mirneye. [score:9]
Similar to methods previously described, [32] we further restricted transgene expression to PRs by incorporating multiple target sequences for miR181, an miRNA endogenously expressed in cells of the inner and middle retina. [score:7]
A hGRK1-GFP-miR181c construct was also generated and packaged in AAV2(quad Y−F+T−V) by inserting four tandem copies of complementary sequence for mature miR-181 (5′ ACTCACCGACAGGTTGAA 3′) (Atlas of miRNA distribution: http://mirneye. [score:1]
[1 to 20 of 3 sentences]
53
[+] score: 17
Hsa-miR-424 had the highest degree of regulation in the MiRNA-Gene-Network; 37 target genes were down-regulated in the mRNA expression profiles, followed by hsa-miR-144 with 23 target genes and hsa-miR-302a, hsa-miR-181b and hsa-520d-3p, both had 20 target genes in the network. [score:13]
Of the 12 miRNAs in the network, 3 were down-regulated in active TB, namely hsa-miR-155, hsa-miR-181b and hsa-548b-3p. [score:4]
[1 to 20 of 2 sentences]
54
[+] score: 17
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-101-1, hsa-mir-106a, hsa-mir-107, hsa-mir-16-2, hsa-mir-192, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-129-1, hsa-mir-148a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181c, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-210, hsa-mir-212, hsa-mir-214, hsa-mir-215, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-129-2, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-130b, hsa-mir-376c, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-20b, hsa-mir-429, hsa-mir-449a, hsa-mir-433, hsa-mir-451a, hsa-mir-193b, hsa-mir-520d, hsa-mir-503, hsa-mir-92b, hsa-mir-610, hsa-mir-630, hsa-mir-650, hsa-mir-449b, hsa-mir-421, hsa-mir-449c, hsa-mir-378d-2, hsa-mir-744, hsa-mir-1207, hsa-mir-1266, hsa-mir-378b, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-4512, hsa-mir-378i, hsa-mir-203b, hsa-mir-451b, hsa-mir-378j
Moreover, GC patients with over -expression of miR-107 [28, 29, 30], miR-143 [40], miR-145 [41, 42], miR-181b/c [17, 47, 48, 55, 56], miR-196a/b [59], miR-20b [23, 66], miR-23a/b [77, 78, 79], miR-34 [17, 47, 48, 55, 56] and miR-630 [100] and decreased expression of miR-1 [111], miR-1207-5p [121], miR-125a-3p/-5p [24, 125, 126, 127], miR-185 [140], miR-193b [60], miR-20a [111], miR-206 [150, 151], miR-215 [142], miR-217 [153], miR-27a [111], miR-29c [169], miR-34a [172, 173], miR-423-5p [111], and miR-520d-3p [99] indicate advanced tumor stage or TNM stage. [score:5]
The tumor suppressors miR-15b, miR-16 and miR-181b have been shown to inhibit chemotherapeutic drug -induced apoptosis [47, 48]. [score:5]
Moreover, several oncomiRs, namely miR-15b, miR-16, miR-181b and miR-34, directly target the gene encoding the anti-apoptotic protein Bcl-2, and thus promote apoptosis in GC. [score:4]
Zhu W. Shan X. Wang T. Shu Y. Liu P. miR-181b modulates multidrug resistance by targeting BCL2 in human cancer cell lines Int. [score:3]
[1 to 20 of 4 sentences]
55
[+] score: 17
The striking up-regulation of all the members of the miR-181 family upon lt-NES cell differentiation (Figure 1E right panel) points to potential roles of these miRNAs in human neuronal lineage. [score:4]
Expression of miR-181 family members can be detected in a variety of tissues, with the highest levels found in the brain [37]– [39]. [score:3]
Figure S2 Expression of miR-181 family members in hES cells, lt-NES cells and derived differentiating cultures. [score:3]
Northern blot analyses showing expression of mature miR-181b, miR-181c and miR-181d in human ES cells (ES), lt-NES cells (NES) and lt-NES cells differentiated for 15 days (ND15) and 30 days (ND30) from the I3 and H9.2 cell lines. [score:3]
The other members of the miR-181 family showed comparable expression patterns (Figure S2). [score:3]
Among these, we found miR-153, miR-324-5p/3p and the miR-181 family (Figure 1E right panel), for which evidence from other studies points to potential roles in the nervous system. [score:1]
[1 to 20 of 6 sentences]
56
[+] score: 17
Similarly, major product, miR-181 was strongly up-regulated during RA treatment while the minor product, miR-181* was not detected in any cell type. [score:4]
Similarly, miR-181 family members, which are located in three genomic clusters: mir-181a-1 and mir-181b-1 on chromosome 1; mir-181a-2 and mir-181b-2 on chromosome 9; and mir-181c and mir-181d on chromosome 19, were all up-regulated during the RA time-course, but miR-181a* and miR-181d had log2 intensity below threshold at 28 days RA (Fig. 3B). [score:4]
The expression levels of the same miR-302 (A; bottom left panel) and miR-181 (B; bottom right panel) genomic clusters in NT2-undiff and NT2-28D plotted as yellow and blue bars, respectively. [score:3]
The expression levels of the members of the miR-302 (A) and the miR-181 (B) genomic clusters during neural differentiation plotted as heatmaps (top panels). [score:3]
0011109.g003 Figure 3The expression levels of the members of the miR-302 (A) and the miR-181 (B) genomic clusters during neural differentiation plotted as heatmaps (top panels). [score:3]
[1 to 20 of 5 sentences]
57
[+] score: 17
Down-regulation of miR-144-3p, miR-181b-5p, miR-320a, miR-320c, miR-320d and miR-451a separated melanoma from normal skin; and down-regulation of miR-203, miR-205, miR-211 (and its homologue, miR-204), miR-23b, miR-26a and miR-26 distinguished melanoma from nevus. [score:7]
Using DIANA mirPath software [36], gene targets were interrogated for miR-144-3p, miR-181b-5p, miR-320a, miR-320c, miR-320d and miR-451a down-regulated in PCM vs. [score:6]
miR-144-3p, miR-181b-5p, miR-320a, miR-320c, miR-320d and miR-451a were down-regulated in PCM vs. [score:4]
[1 to 20 of 3 sentences]
58
[+] score: 17
The four studies considered for the comparison, including the present study, demonstrated the higher expression in naïve B-cells of mir-320, the up-regulation of mir-181b, mir-25, miR-130b in GC B cells as well as the greater expression of both mir-29a and seven members linked to the cluster miR-17/92 in mature B cells. [score:7]
The miRNAs profile comparison between resting and activated B cells showed the up-regulation of 19 miRNA in activated B cells: mir-98, mir-106a, mir-20a, mir-17-5p, mir-20b, mir-16-2, mir-18a, mir-155, mir-21, mir-181d, mir-425-5p, mir-148a, mir-15b, mir-15a, mir-181b mir-181c, mir-181a, mir-130b, mir-148b (Table 3). [score:4]
Other miRNAs such as mir-155, mir-181b, mir-15a, mir-16, mir-15b, mir-34a, mir-9, mir-30, let-7a, mir-125b, mir-217 and mir-185 modulate the expression of pivotal genes and functions which contribute to the final B-cell maturation [6]. [score:3]
Considering all differentially expressed miRNAs, we detected miR-150, miR-361, miR-130b, miR-181b and members of miRNA clusters miR-17-5p, miR-106a, miR-20a and miR-20b as the most variable miRNAs (FDR = 0.0077) (Table 1). [score:3]
[1 to 20 of 4 sentences]
59
[+] score: 17
For example, miR-181 upregulates expression of let-7 by effectively repressing Lin28 expression, and eventually promoting megakaryocytic differentiation, thus providing insight into future development of miRNA-oriented therapeutics [33]. [score:9]
It has been reported that Lin28 mRNA expression can be depressed by several other miRNAs including miR-125, miR-9, and miR-30 [39] and miR-181 [33], and Lin28 expression can be modulated by proteasome inhibitors such as MG132 [40]. [score:7]
Li X. Zhang J. Gao L. McClellan S. Finan M. A. Butler T. W. Owen L. B. Piazza G. A. Xi Y. MiR-181 mediates cell differentiation by interrupting the Lin28 and let-7 feedback circuit Cell Death Differ. [score:1]
[1 to 20 of 3 sentences]
60
[+] score: 16
Value Targets INTERACTION EFFECT miR-205 +2.44 CDH1, ZEB1/2, ERRB3, AKTCarraway et al., 1997 miR-155 +1.90 Inhibits negative regulators of inflammation (SHIP1, SOCS)Elton et al., 2013 miR-10b +1.48 HOXA1 and NFKBFang et al., 2010; Tonja, 2012 miR-31 +1.38 ICAM1, E-SelectinSuárez et al., 2010 miR-181 −1.60 Zeb2, MCL1, BCL2L11, BCL2,PTEN, DUSP6, PTPN11Pati et al., 2014 miR-17 −1.83 APP, TGFBRII, SMAD2, SMAD4, p21, BIM (BCL2L11), PTEN. [score:6]
In fact, miR-181 is induced by LIF, a cytokine which inhibits the proliferation of stem cells, and hence, it inhibits neurogenesis (Pati et al., 2014). [score:5]
One of the target of miR-181 is MCL1, which however, has two isoforms: while the isoform 1 is anti-apoptotic, the isoform 2 is pro-apoptotic. [score:3]
The evaluation of miR-181 effects according to its targets, suggests that Older Men Group could have higher levels than Older Women Group of the following activities: more cell adhesion (i. e., more CdhE due to low ZEB2), viability (more PI3K/AKT due to low PTEN), more MAPK signaling (i. e., potentially more ERK [*], JUN [*], p38 [*]), more pro-apoptotic activity (less Bcl2), and low cytoskeleton organization (less RhoA activation due to the loss of PTPN11 effect on Rock2). [score:1]
The negative super-ratio observed with miR-181 (interaction = −1.60) is also consistent with the miR-17 finding. [score:1]
[1 to 20 of 5 sentences]
61
[+] score: 16
Differential expression of RNAseq data identified 12 miR with changes in relative expression during follicular trachoma, of which 9 were confirmed as differentially expressed by qPCR (miR-155, miR-150, miR-142, miR-181b, miR-181a, miR-342, miR-132, miR-4728 and miR-184). [score:7]
are shown in Table  2. MiR-155, miR-150, miR-142, miR-181b, miR-181a and miR-342 were up-regulated in all 3 comparisons (Fig.   2). [score:4]
MiR-155, miR-150, miR-142, miR-181b, miR-181a, miR-342 and miR-132 were differentially expressed during current Ct infection. [score:3]
MiR-181b, miR-132, miR-10a and miR-146b negatively regulate inflammation following TLR or NFκB stimulation in order to prevent excessive inflammation and pathology. [score:2]
[1 to 20 of 4 sentences]
62
[+] score: 16
In addition to let-7, the miRNAs miR-26a, miR-181, miR-9, miR-30, miR-125, miR-212 and miR-27 have also been shown to directly bind the 3′UTR of LIN28A/LIN28B and repress translation of the protein, and as these miRNAs are frequently under-expressed in malignant tumors, higher levels of LIN28 expression are seen [31– 34]. [score:8]
MiR-181b and miR-21 target cylindromatosis (CYLD) and phosphatase and tensin homolog (PTEN), respectively, and down-regulation of CYLD and PTEN leads to NF-κB activation, therefore also acting as a part of the epigenetic switch linking inflammation to cancer [73]. [score:6]
Furthermore, they showed that STAT3 directly activated miR-181b and miR-21 at the transcriptional level. [score:2]
[1 to 20 of 3 sentences]
63
[+] score: 15
Substantial down-regulation of miR-181a and miR-181b has been observed in both human glioma samples and in established glioma cell lines [23]. [score:4]
The anti-apoptotic protein BCL2 is a validated target of miR-181b[24] and miR-16[25]. [score:3]
Meanwhile, miR-181b has been strongly implicated as a tumor suppressor in glioblastoma. [score:3]
Expression of miR-181 was abundant in normal brain tissue, but dropped substantially with increasing WHO grades [23]. [score:3]
Notably, transfection of miR-181b into glioblastoma cells significantly inhibited cell invasion in an in vitro matrigel invasion assay and increased apoptosis in the transfected cells [23]. [score:2]
[1 to 20 of 5 sentences]
64
[+] score: 15
Interestingly, several immune-related miRNAs were abundant in the milk (Figure 1b): miR-155, a regulator of T- and B-cell maturation and the innate immune response; miR-181a and miR-181b, regulators of B-cell differentiation and CD4+ T-cell selection; miR-17 and miR-92 cluster: a ubiquitous regulator of B-cell, T-cell and monocyte development, miR-125b, a negative regulator of tumor necrosis factor-α production, activation and sensitivity; miR-146b, a negative regulator of the innate immune response; miR-223, a regulator of neutrophil proliferation and activation; and let-7i, a regulator of Toll-like receptor 4 expression in human cholangiocytes. [score:11]
Furthermore, human breast milk miRNAs may induce B-cell differentiation, because the milk is rich in miR-181 and miR-155, both known to induce B-cell differentiation [19, 20], but it is not rich in miR-150, which suppresses B-cell differentiation [21, 22]. [score:3]
On the other hand, breast milk is rich in miR-181 and miR-155, and these were detected at similar levels in serum. [score:1]
[1 to 20 of 3 sentences]
65
[+] score: 15
We also detected upregulated miR-181b-5p and −186-5p, which may suppress plasminogen activator inhibitor-1 in VSMCs (Chen et al. 2014) and promote apoptosis (Zhou et al. 2008), thus interfering with extracellular matrix degradation, and structural and functional changes in VSMCs. [score:8]
The expression of 4 miRNAs (miR-181-5p, −186-5p, −28-5p and −155-5p) differed statistically significantly (p < 0.001) between healthy HSMCs and AthSMCs in the low IL-6 producer group. [score:3]
It was observed that in the “low IL-6 producer” group (Figure  3), the expression of 4 miRNAs (miR-181b-5p, −186-5p, −28-5p and −155-5p) differed statistically significantly between HSMCs and AthSMCs (p <0.001; Mann- Whitney U test). [score:3]
Figure 3Fold changes of miRNAs (A; miR-181b-5p, B;186-5p, C; 28-5p, D;155-5p, E;150-5p, F; 9-5p) and IL-6 levels after streptococci or P. gingivalis stimulation in healthy SMCs (HSMCs) and atheroma derived SMCs (AthSMCs). [score:1]
[1 to 20 of 4 sentences]
66
[+] score: 14
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-30a, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-105-1, hsa-mir-105-2, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-181a-2, hsa-mir-181c, hsa-mir-182, hsa-mir-205, hsa-mir-212, hsa-mir-181a-1, hsa-mir-222, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-141, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-188, hsa-mir-320a, hsa-mir-181b-2, hsa-mir-30c-1, hsa-mir-302a, hsa-mir-34c, hsa-mir-30e, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-372, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-383, hsa-mir-339, hsa-mir-133b, hsa-mir-345, hsa-mir-425, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-193b, hsa-mir-181d, hsa-mir-498, hsa-mir-518f, hsa-mir-518b, hsa-mir-520c, hsa-mir-518c, hsa-mir-518e, hsa-mir-518a-1, hsa-mir-518d, hsa-mir-518a-2, hsa-mir-503, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-376a-2, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-645, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-744, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-302e, hsa-mir-302f, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-378b, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-320e, hsa-mir-548x, hsa-mir-378c, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, hsa-mir-371b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
With the mouse mo del, it has been shown that a minimal uterine expression of miR-181 is essential for the onset of embryo implantation and that it is regulated by the leukemia inhibitory factor (LIF) [80]. [score:6]
Also miRNA precursors are present in human sperm, such as pri-miR-181, whose targets might have a function in early embryonic development and globally decrease at the 4–8-cell stage of human embryo development [8]. [score:5]
A specific target of pri-miRNA-181 is the embryonic stem cell pluripotency factor, termed coactivator -associated arginine methyltransferase I (CARM1). [score:3]
[1 to 20 of 3 sentences]
67
[+] score: 14
In particular, the following target proteins were downregulated: PTEN which is known to be targeted by miR-21 [28], [29], cyclin D1 which is known to be targeted by miR-100, miR-99a and miR-223 [30] and Bcl-2 which is known to be targeted directly by miR-34, miR-181b and miR-16 [31], [32], [33] or indirectly modulated by miR-21 [34]. [score:14]
[1 to 20 of 1 sentences]
68
[+] score: 14
miR-138 is upregulated in glioma cells with acquired TMZ resistance and in recurrent glioblastomas in vivoMicroarray -based miRNA expression profiling of parental and TMZ-resistant (TMZR) LN-18, LN-229 and LN-308 cells revealed several differentially expressed MiRNAs (Figure 1A), including several miRNAs previously implicated in TMZ resistance, such as mir-125b [10], miR-181 [12] or miR-221/222 [13]. [score:8]
Microarray -based miRNA expression profiling of parental and TMZ-resistant (TMZR) LN-18, LN-229 and LN-308 cells revealed several differentially expressed MiRNAs (Figure 1A), including several miRNAs previously implicated in TMZ resistance, such as mir-125b [10], miR-181 [12] or miR-221/222 [13]. [score:5]
MiRNAs associated with TMZ resistance in glioblastoma include miR-195 [8], miR-9 [9], miR-125b [10], miR-136 [11], miR-181b [12], and miR-221/222 [13]. [score:1]
[1 to 20 of 3 sentences]
69
[+] score: 14
After determining the expression levels of these miRNAs in the same 7 pairs of NSCLC tissues and normal adjacent tissues, we observed that 8 miRNAs (miR-203, miR-30, let-7, miR-132, miR-181, miR-212, miR-101 and miR-9) were downregulated in the NSCLC tissues, while the other 5 miRNAs (miR-125, miR-98, miR-196, miR-23 and miR-499) were upregulated (Fig. S1). [score:9]
In addition to let-7, miR-181 26, miR-30 29, miR-9 27 28, miR-132 32 33, miR-101 30 and miR-212 31 have also been shown to directly bind the 3′-UTR of LIN28B and repress the translation of this protein. [score:4]
A total of 13 miRNAs, including miR-203, miR-30, let-7, miR-132, miR-181, miR-212, miR-101, miR-9, miR-125, miR-98, miR-196, miR-23 and miR-499, were identified as candidate miRNAs by all three computational algorithms (Table S2). [score:1]
[1 to 20 of 3 sentences]
70
[+] score: 14
Interestingly, mutation of the miR181 site also decreased of luciferase in pMirTarget 3′ UTR hGRβ, but this was not observed in the UMUC-3. Total RNA was extracted from the UMUC-3 and T24 cells to measure the miRNA expression that may target the 3′ UTR of human GRβ (Figure 5C). [score:6]
Insulin did not significantly change expression of miR33a, miR144, miR181a, miR181b, miR181c, or miR181d in the T24 cells. [score:3]
Next, we wanted to determine if miR33a, miR144, miR181a, miR181b, miR181c, or miR181d changed during a scratch assay and if this affected the human GRβ or GRα expression. [score:2]
The T24 and UMUC-3 bladder cancer cells were transfected with the 3′UTR GRβ-Luc expression construct with mutation in the miRNA binding site for miR181, miR144, or miR33a and was measured by a luciferase assay, and normalized to renilla (B). [score:1]
Interestingly, miR33a, miR144, miR181a, miR181b, miR181c, and miR181d were all increased in the T24 cells. [score:1]
Three miRNAs were predicted to bind the 3′UTR of human GRβ (miR33a, miR181-a/b/c/d, and miR144). [score:1]
[1 to 20 of 6 sentences]
71
[+] score: 14
miRNAs (e. g. miR-146a[49], miR-34[50], miR-181[51]) that downregulate protective genes against AD (e. g., complement factor H)/upregulate “pro-AD” genes (e. g. p53, SIRT1)/are correlated with amount of Aβ plaque and NFTs, exhibit upregulated in the brain and/or peripheral circulation of AD patients. [score:10]
Addition of Aβ peptides to primary neuronal cell cultures/primary human astrocytes cultures has been shown to downregulate miR-9/miR-181[51]. [score:4]
[1 to 20 of 2 sentences]
72
[+] score: 14
miR-181a, miR-181c and miR-181d were downregulated in two normal aging mouse mo dels, C57BL/6J and CBA/J [82], implying that aging can lead to decreased levels of miR-181, which then inhibits proliferation. [score:6]
Upregulation of miR-181a and miR-181b in the chick inner ear was found at P0 and P8, and it gradually decreases towards the adult stage [78]. [score:4]
MiR-181 is known to cause proliferation of hair cells in the chicken inner ear and inhibition of miR-181a reduces proliferation [85]. [score:3]
This suggests that during the early post-natal growth of the inner ear, miR-181 is required, but may not be necessary during the adult stage. [score:1]
[1 to 20 of 4 sentences]
73
[+] score: 14
All the isoforms and combined sum of expression of isoforms showed the same pattern in plots created using our tool as shown in the paper, with poor overall survival observed in the group having low expression of miR-181 isoforms. [score:5]
In another study, Chen et al [61], have demonstrated down-regulation of several isoforms of miR-181 (miR-181-a, miR-181-b, miR-181-c and miR-181-d) being correlated with poor overall survival in acute myeloid leukemia (AML). [score:4]
Prognostic plot for sum of expression of hsa-mir-181 isoforms a,b,c and d in TCGA AML data. [score:3]
Additional file 1: Figures S1-S4 provided in supplementary data show prognostic plots for miR-181 isoforms in AML data. [score:1]
Prognostic plot created using PROGmiR for isoforms a, b, c and d of miRNA hsa-miR-181 identified as prognostically important biomarker in Acute Myeloid Leukemia (AML) by Chen et al, using TCGA data. [score:1]
[1 to 20 of 5 sentences]
74
[+] score: 14
Suppression of miR-181-a/-b produced a significant delay in tumour development in a mouse mo del of MM, confirming that this miRNA nourishes MM tumour growth. [score:4]
Pichiorri et al. [25] have shown that miR-181-a/-b, miR-106b~25 and miR-32 are up-regulated in MGUS, MM primary cells and cell lines. [score:4]
Moreover, miR-21, as well as miR-181-a/-b, is upregulated in two drug resistant MM cell lines when compared with parental line [31]. [score:3]
Finally, miR-181-a/-b were significantly upregulated in two drug resistant MM cell lines when compared with parental line [31]. [score:3]
[1 to 20 of 4 sentences]
75
[+] score: 13
Three miRNAs were significantly down-regulated in serum from persistently infected cattle: bta-miR-1281, bta-miR-181b, and bta-miR-23b-5p with fold decreases of 3.41, 2.77, and 2.44, respectively (Table  3). [score:4]
In contrast, the ViTa algorithm found that more of these miRNAs could potentially target the genome, adding bta-miR-205, bta-miR-26b, bta-let-7 g, bta-miR-34a, bta-miR-144, bta-miR-181b, and bta-miR-147 to the list. [score:3]
Of the differentially regulated miRNAs, 16 (bta-miR-23b-5p, let-7 g, bta-miR-22-5p, bta-miR-1224, bta-miR-144, bta-miR-497, bta-miR-455-3p, bta-miR-154a, bta-miR-369-3p, bta-miR-26b, bta-miR-34a, bta-miR-205, bta-miR-181b, bta-miR-146a, bta-miR-17-5p, and bta-miR-31) have previously been described to play a role in cellular proliferation or apoptosis (Fig.   6b, orange circle). [score:2]
Eleven of the miRNAs are encoded in intergenic regions, including: bta-miR-1281, bta-miR-150, bta-miR-181b, bta-miR-497, bta-miR-144, bta-miR-34a, bta-miR-154a, bta-miR-146b, bta-miR-17-5p, bta-miR-205, and bta-miR-31. [score:1]
The remaining 8 miRNAs (bta-miR-497, bta-miR-144, bta-miR-181b, bta-miR-22-5p, bta-miR-23b-5p, bta-miR-17-5p, bta-miR-154a, and bta-miR-369-3p) detected in this study were found to be clustered. [score:1]
Nine of the miRNAs (bta-miR-26b, bta-miR-34a, bta-miR-205, bta-miR-181b, bta-miR-146a, bta-miR-17-5p, bta-miR-31, bta-miR-150, and bta-miR-147), have been ascribed immune modulatory functions (Fig.   6b, blue circle). [score:1]
The only chromosomes in the Bos taurus genome that were associated with more than one of the identified miRNAs were: chromosome #8 with bta-miR-23b-5p, bta-miR-31, and bta-miR-455-3p; chromosome #16 with bta-miR-34a, bta-miR-181b, and bta-miR-205; chromosome #19 with bta-miR-22-5p, bta-miR-144, and bta-miR-497; and finally chromosome #21 with bta-miR-154a and bta-miR-369-3p. [score:1]
[1 to 20 of 7 sentences]
76
[+] score: 13
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-31, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-30c-2, hsa-mir-147a, hsa-mir-10a, hsa-mir-34a, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-204, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-193a, hsa-mir-195, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-30c-1, hsa-mir-219a-2, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-302d, hsa-mir-374a, hsa-mir-375, hsa-mir-378a, hsa-mir-330, hsa-mir-328, hsa-mir-342, hsa-mir-325, hsa-mir-424, hsa-mir-429, hsa-mir-450a-1, hsa-mir-486-1, hsa-mir-146b, hsa-mir-497, hsa-mir-520e, hsa-mir-520f, hsa-mir-520a, hsa-mir-520b, hsa-mir-520c, hsa-mir-520d, hsa-mir-520g, hsa-mir-520h, hsa-mir-450a-2, hsa-mir-503, hsa-mir-608, hsa-mir-625, hsa-mir-629, hsa-mir-663a, hsa-mir-1271, hsa-mir-769, hsa-mir-378d-2, hsa-mir-675, hsa-mir-147b, hsa-mir-374b, hsa-mir-663b, hsa-mir-378b, hsa-mir-378c, hsa-mir-374c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-4661, hsa-mir-219b, hsa-mir-203b, hsa-mir-378j, hsa-mir-486-2
Kronski E. Fiori M. E. Barbieri O. Astigiano S. Mirisola V. Killian P. H. Bruno A. Pagani A. Rovera F. Pfeffer U. miR181b is induced by the chemopreventive polyphenol curcumin and inhibits breast cancer metastasis via down-regulation of the inflammatory cytokines CXCL1 and -2Mol. [score:6]
Kronski et al. [20] verified that the upregulation of miR-181b in breast cancer cells after treatment with curcumin is related to a down-modulation of pro-inflammatory cytokines CXCL1 and -2, causing an inhibitory effect on the metastatic process of these cells. [score:6]
Iliopoulos D. Jaeger S. A. Hirsch H. A. Bulyk M. L. Struhl K. STAT3 activation of miR-21 and miR-181b-1 via PTEN and CYLD are part of the epigenetic switch linking inflammation to cancerMol. [score:1]
[1 to 20 of 3 sentences]
77
[+] score: 13
Overexpression of miR-9 or miR-181b suppressed As [III] -induced NRP1 expression, cell migration and tube formation, supporting involvement of these miRNA species in As [III] -induced angiogenesis via NRP1 gene activation. [score:7]
NRP1—a transmembrane receptor involved in angiogenesis—which is upregulated at the mRNA level in arsenic -treated chick embryos was found to be a target gene of miR-9 and miR-181b. [score:6]
[1 to 20 of 2 sentences]
78
[+] score: 13
As a critical regulator of tumor cell migration and invasion and breast cancer progression in vitro, miR-181 could potentially be an important therapeutic target [243]. [score:4]
We and others have demonstrated the mir-181 family of microRNAs to be up-regulated by TGF β and activin, a closely related TGF β family member [243, 247, 249]. [score:4]
In hepatocellular carcinoma, TGF β -induced miR-181 targets TIMP3 for degradation, thereby increasing invasiveness of the cells [247]. [score:3]
We also found miR-181 to be a downstream regulator of activin/TGF β -induced cellular migration and invasion in breast cancer (Figure 4). [score:2]
[1 to 20 of 4 sentences]
79
[+] score: 13
miR-15b, miR-16, miR-181b and miR-34 have the same downstream target, B-cell lymphoma 2 (BCL-2), which exhibits an antiapoptotic function; overexpression of these miRNAs inhibits the expression of BCL-2 and induces apoptosis. [score:9]
Furthermore, through the negative regulation of BCL-2 expression, miR-15a, miR-16 and miR-181b may contribute to the repression of multidrug resistance associated with the modulation of apoptosis in human GC cell lines (38– 40). [score:4]
[1 to 20 of 2 sentences]
80
[+] score: 12
For example, the expressions of miR-181c and -181d were decreased after inhibiting β-catenin activity, confirming the positive correlation of miR-181 family members’ expression and β-catenin [43]. [score:7]
In contrast, expression levels of miR-181 family members, including miR-181d, were significantly reduced after blocking the activity of β-catenin, suggesting that miR-181d might antagonize the effects of β-catenin inhibition, thereby inducing drug resistance. [score:5]
[1 to 20 of 2 sentences]
81
[+] score: 12
hsa-mir-155 HMDD hsa-mir-101 mir2Disease hsa-mir-19b HMDD hsa-mir-146a mir2Disease hsa-mir-21 HMDD hsa-mir-373 HMDD hsa-mir-92a HMDD hsa-mir-214 HMDD hsa-mir-9 HMDD hsa-mir-143 HMDD hsa-mir-451 HMDD hsa-mir-25 HMDD hsa-mir-125b HMDD hsa-mir-181b HMDD hsa-mir-24 HMDD hsa-mir-20b uncomfirmed hsa-mir-145 HMDD hsa-mir-32 HMDD hsa-mir-223 HMDD hsa-mir-16 HMDD 10.1371/journal. [score:5]
hsa-mir-155 HMDD hsa-mir-101 mir2Disease hsa-mir-19b HMDD hsa-mir-146a mir2Disease hsa-mir-21 HMDD hsa-mir-373 HMDD hsa-mir-92a HMDD hsa-mir-214 HMDD hsa-mir-9 HMDD hsa-mir-143 HMDD hsa-mir-451 HMDD hsa-mir-25 HMDD hsa-mir-125b HMDD hsa-mir-181b HMDD hsa-mir-24 HMDD hsa-mir-20b uncomfirmed hsa-mir-145 HMDD hsa-mir-32 HMDD hsa-mir-223 HMDD hsa-mir-16 HMDD 10.1371/journal. [score:5]
hsa-mir-25 HMDD hsa-mir-218 HMDD hsa-mir-1 HMDD hsa-mir-18a HMDD hsa-mir-223 HMDD hsa-mir-181b HMDD hsa-mir-34a HMDD hsa-mir-19a HMDD hsa-mir-372 unconfirmed hsa-mir-214 HMDD hsa-mir-19b HMDD hsa-mir-16 HMDD hsa-mir-133a HMDD hsa-mir-92a HMDD hsa-mir-143 HMDD hsa-mir-34b HMDD hsa-mir-218 HMDD hsa-mir-20b HMDD hsa-mir-18a HMDD hsa-mir-106b HMDD 10.1371/journal. [score:1]
hsa-mir-25 HMDD hsa-mir-218 HMDD hsa-mir-1 HMDD hsa-mir-18a HMDD hsa-mir-223 HMDD hsa-mir-181b HMDD hsa-mir-34a HMDD hsa-mir-19a HMDD hsa-mir-372 unconfirmed hsa-mir-214 HMDD hsa-mir-19b HMDD hsa-mir-16 HMDD hsa-mir-133a HMDD hsa-mir-92a HMDD hsa-mir-143 HMDD hsa-mir-34b HMDD hsa-mir-218 HMDD hsa-mir-20b HMDD hsa-mir-18a HMDD hsa-mir-106b HMDD 10.1371/journal. [score:1]
[1 to 20 of 4 sentences]
82
[+] score: 12
We found that LMP1 could induce the expression of several miRNAs such as miR-155, miR-188, miR-181b while other cellular miRNAs such as miR-103, miR-107 were downregulated. [score:6]
LMP2A also induced the expression of a variety of cellular miRNAs such as miR-155, miR-188, miR-181b while some other cellular miRNAs such as miR-125b were downregulated (Table 1 ). [score:6]
[1 to 20 of 2 sentences]
83
[+] score: 12
Moreover, miR-181 targets TIMP3 that is an inhibitor of metalloprotease, inductor of apoptosis and inhibits angiogenesis, cell migration and invasion [174]. [score:7]
It is clear that the induction of metastasis through TGF-beta/SMAD4/miR-181b leads to inhibition of metastatic negative regulators such as TIMP3 and over-activation of metalloproteinases. [score:4]
Recently, Wang and co-workers have shown that miR-181b is transcriptionally induced by TGF-beta signaling pathway through SMAD4. [score:1]
[1 to 20 of 3 sentences]
84
[+] score: 12
Namely, hsa-miR-22, a cell growth inhibitor, hsa-miR-181b, hsa-miR-320 and hsa-let-7e, all tumor suppressor miRNAs, were all upregulated in the first 6 h post-infection as part of the host-cell immune response to the virus. [score:8]
Among them are hsa-miR-22, hsa-miR-181b and hsa-miR-320 that were overexpressed at 6 and 12 h post-infection as part of the host immune response to the virus. [score:3]
The most noteworthy miRNAs referred in both studies were hsa-miR-27a/b, hsa-miR-30a/b/c, hsa-miR-125a/b, hsa-miR-181b, and hsa-let-7e (Qi et al., 2010; Zhao et al., 2015). [score:1]
[1 to 20 of 3 sentences]
85
[+] score: 12
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-106a, hsa-mir-16-2, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181c, hsa-mir-182, hsa-mir-204, hsa-mir-205, hsa-mir-181a-1, hsa-mir-216a, hsa-mir-217, hsa-mir-223, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-149, hsa-mir-150, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-200a, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-370, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-335, hsa-mir-133b, hsa-mir-451a, hsa-mir-146b, hsa-mir-494, hsa-mir-193b, hsa-mir-181d, hsa-mir-92b, hsa-mir-574, hsa-mir-605, hsa-mir-33b, hsa-mir-378d-2, hsa-mir-216b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-378b, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-451b, hsa-mir-378j
Pekarsky Y. Santanam U. Cimmino A. Palamarchuk A. Efanov A. Maximov V. Volinia S. Alder H. Liu C. G. Rassenti L. Tcl1 expression in chronic lymphocytic leukemia is regulated by miR-29 and miR-181 Cancer Res. [score:4]
In particular, miR-181 and miR-155, which are known to regulate B cell differentiation [48, 105, 106], are present in high concentrations in HM [44, 48], suggesting a function in the development of the infant’s immune system. [score:3]
De Yebenes V. G. Belver L. Pisano D. G. Gonzalez S. Villasante A. Croce C. He L. Ramiro A. R. miR-181b negatively regulates activation -induced cytidine deaminase in B cells J. Exp. [score:2]
Iliopoulos D. Jaeger S. A. Hirsch H. A. Bulyk M. L. Struhl K. STAT3 activation of miR-21 and miR-181b-1 via PTEN and CYLD are part of the epigenetic switch linking inflammation to cancer Mol. [score:1]
HM is rich in B cell-related microRNAs, such as miR-181 and miR-155, which potentially induce B cell differentiation [108, 110]. [score:1]
[52, 55, 56] miR-181b Switch recombination in activated B cells. [score:1]
[1 to 20 of 6 sentences]
86
[+] score: 11
In the context of leukemia, overexpression of hsa-miR-181b-5p was shown to enhance proliferation in acute myeloid leukemia by targeting MLK2. [score:5]
Although most of the newly detected miRNAs in T-ALL were expressed at very low levels, we also identified a selection of novel T-ALL miRNAs with very high expression levels in T-ALL patient samples, including hsa-miR-181b-5p, hsa-miR-423-3p, hsa-miR-486-5p and hsa-miR-92b-3p (Fig.   1b). [score:5]
For example, hsa-miR-181b-5p is a known oncogene in several cancer types as reviewed by Liu et al. [20]. [score:1]
[1 to 20 of 3 sentences]
87
[+] score: 11
The miR-181 family has been shown to exert oncogenic effects via suppression of the apoptosis gene Bcl-2. Therefore, the sequestration of miR-181a by MEG3 results in upregulation of Bcl-2, and suppresses gastric carcinogenesis [22]. [score:8]
LncRNA MEG3 was also found to be capable of inhibiting gastric cancer cell proliferation, migration, and invasion by competitively binding with members of the miR-181 family such as MEG3 sequestering oncogenic miR-181a (Table 1 and Figure 1). [score:3]
[1 to 20 of 2 sentences]
88
[+] score: 11
miR-181 expression was also enhanced in SPARC expressed medulloblastoma cells compared to controls. [score:4]
Several studies have showed that mir-181a and mir-181b act as tumor suppressor genes. [score:3]
miR-181 expression was shown to enhance radio and chemo sensitivity [61– 63]. [score:3]
Taken together, these findings support the hypothesis that mir-181 may be involved in enhancing radio response in medulloblastoma. [score:1]
[1 to 20 of 4 sentences]
89
[+] score: 11
In contrast, miR-181a and miR-181b had higher expression level than miR-544a and target the same reporter construct; however, no silencing effect was observed. [score:5]
One construct was used for both miR-181a and miR-181b (miR-181a/b), since their target sequences resulted overlapped. [score:3]
One reporter construct was prepared for both miR-181a-5p and miR-181b-5p, since their target sites resulted overlapped. [score:3]
[1 to 20 of 3 sentences]
90
[+] score: 11
severe (p<0.05) cfa-let-7d, cfa-miR-101, cfa-miR-10a, cfa-miR-1296, cfa-miR-1306, cfa-miR-1307, cfa-miR-130a, cfa-miR-136, cfa-miR-17, cfa-miR-181b, cfa-miR-196b, cfa-miR-197, cfa-miR-215, cfa-miR-22, cfa-miR-30d, cfa-miR-33b, cfa-miR-497, cfa-miR-503, cfa-miR-574, cfa-miR-628, cfa-miR-676 Comparing the miRNA differential expression analyses between disease states obtained by RT-qPCR and RNAseq, we observed discordances between the two methods. [score:5]
severe (p<0.05) cfa-let-7d, cfa-miR-101, cfa-miR-10a, cfa-miR-1296, cfa-miR-1306, cfa-miR-1307, cfa-miR-130a, cfa-miR-136, cfa-miR-17, cfa-miR-181b, cfa-miR-196b, cfa-miR-197, cfa-miR-215, cfa-miR-22, cfa-miR-30d, cfa-miR-33b, cfa-miR-497, cfa-miR-503, cfa-miR-574, cfa-miR-628, cfa-miR-676Comparing the miRNA differential expression analyses between disease states obtained by RT-qPCR and RNAseq, we observed discordances between the two methods. [score:5]
severe (p<0.05) cfa-let-7c, cfa-miR-10a, cfa-miR-1307, cfa-miR-132, cfa-miR-136, cfa-miR-181a, cfa-miR-181b, cfa-miR-196b, cfa-miR-20a, cfa-miR-30d, cfa-miR-33b, cfa-miR-34c, cfa-miR-497, cfa-miR-499, cfa-miR-676 Mild vs. [score:1]
[1 to 20 of 3 sentences]
91
[+] score: 11
Their analysis revealed that hsa-miR-181b had high expression level in tumors displaying p53 deletion, and hsa-miR-181b expression level was strongly associated with the mutation status of the p53 in tumor. [score:6]
For example, module 1 contains two miRNAs (hsa-miR-143 and hsa-miR-181b) and three target genes (NOVA1, ST8SIA4, and ZFP36L1). [score:3]
The expression level of hsa-miR-181b was investigated in the study of Xi et al. [25]. [score:1]
Both hsa-miR-143 and hsa-miR-181b are related to colorectal cancer [24, 25]. [score:1]
[1 to 20 of 4 sentences]
92
[+] score: 11
A primary regulator of exercise -induced SIRT1 expression is NAD [+] availability through AMPK (White and Schenk, 2012) and it seems plausible that AMPK, rather than miR-133b or miR-181, may be the primary regulator of post-exercise changes in SIRT1 expression. [score:7]
The expression of miR-181 increased at 4 h post-exercise with PRO (~80%, P < 0.05) that resulted in higher miR-181 with PRO compared to PLA at 4 h (~76%, P < 0.05; Figure 2A). [score:2]
We also found greater miR-133b and miR-181 abundance with post-exercise protein ingestion. [score:1]
Figure 2(A) mir-181-5p, (B) miR-378-5p, (C) miR-486-5p, and (D) miR-494-3p abundance at rest and at 4 h post-exercise recovery following a concurrent exercise session of resistance (8 sets of 5 leg extension at 80% 1-RM) and endurance (30 min cycling at 70% VO [2peak]) exercise and ingestion of either 500-mL PLA or PRO beverage immediately after exercise. [score:1]
[1 to 20 of 4 sentences]
93
[+] score: 11
Other miRNAs from this paper: hsa-mir-181b-2, hsa-mir-193b, hsa-mir-676
To further explore the sensitivity and specificity of cmiRNAs in discriminating between acclimatized and un-acclimatized individuals, we measured the expression levels of has-miR-676-3p (MIMAT0018204), has-miR-3591-3p (MIMAT0019877), has-miR-181b-5p (MIMAT0000257) and has-miR-193b-5p (MIMAT0004767), the most differentially up-regulated cmiRNAs, by qRT-PCR. [score:4]
microRNA name Forward primer Reverse primer miR-181b-5p CACGACACCAACATTCATTGC TATGGTTGTTCTCGTCTCCTTCTC miR-676-3p ACGCCGTCCTGAGGTTGT TATGGTTTTGACGACTGTGTGAT miR-193b-5p AGGCCGGGGTTTTGAGG TATGGTTGTTCACGACTCCTTCAC miR-3591-3p GCCGCTTAAACACCATTGTC TATGCTTGTTCTCGTCTCTGTGTC cel-miR-39 ATATCATCTCACCGGGTGTAAATC TATGGTTTTGACGACTGTGTGAT After microRNA profiling, we searched three well-known target prediction databases, including TargetScan (http://www. [score:3]
Indeed, has-miR-676-3p, has-miR-3591-3p, has-miR-181b-5p, and has-miR-193b-5p were differentially expressed between acclimatized and un-acclimatized individuals. [score:3]
Moreover, among the four cmiRNAs, has-miR-3591-3p, has-miR-676-3p, and has-miR-181b-5p yielded ROC AUCs of 0.805 (P < 0.0001), 0.713 (P < 0.01), and 0.734 (P < 0.01), respectively, indicating that these cmiRNAs were fairly accurate in determining un-acclimatization diagnosis (Figure 5B). [score:1]
[1 to 20 of 4 sentences]
94
[+] score: 10
Activated B cells and CLL cells exhibit similar miR expression profiles that include the upregulation of miR-34a, miR-155, and miR-342-3p and the downregulation of miR-103, miR-181a, and miR-181b [10]. [score:9]
Several investigators have reported that STAT3 is associated with the induction of miRs such as miR-21 and miR-181b-1 [14], [20], and our own analysis in a previous study suggested that STAT3 directly regulates the transcription of a number of miRs including miR-155 (Rozovski et al., submitted). [score:1]
[1 to 20 of 2 sentences]
95
[+] score: 10
Interestingly, members of the miR-181 family consistently upregulated the reporter in the Keklikoglou et al. study, while all four members downregulated reporter activity in our study to varying degrees (see Additional file 1, Table S2). [score:7]
Our results are consistent with a recent study by Sun et al. demonstrating miR-181b inhibition of NF-κB through importin-α3 [38]. [score:3]
[1 to 20 of 2 sentences]
96
[+] score: 10
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-98, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-30b, hsa-mir-130a, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-185, hsa-mir-193a, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-181b-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-363, hsa-mir-374a, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-423, hsa-mir-20b, hsa-mir-491, hsa-mir-193b, hsa-mir-181d, hsa-mir-92b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, bta-mir-29a, bta-let-7f-2, bta-mir-148a, bta-mir-18a, bta-mir-20a, bta-mir-221, bta-mir-27a, bta-mir-30d, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-30b, bta-mir-106a, bta-mir-10a, bta-mir-15b, bta-mir-181b-2, bta-mir-193a, bta-mir-20b, bta-mir-30e, bta-mir-92a-2, bta-mir-98, bta-let-7d, bta-mir-148b, bta-mir-17, bta-mir-181c, bta-mir-191, bta-mir-200c, bta-mir-22, bta-mir-29b-2, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-25, bta-mir-363, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-15a, bta-mir-19a, bta-mir-19b, bta-mir-331, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, bta-mir-1-2, bta-mir-1-1, bta-mir-130a, bta-mir-130b, bta-mir-152, bta-mir-181d, bta-mir-182, bta-mir-185, bta-mir-24-1, bta-mir-193b, bta-mir-29d, bta-mir-30f, bta-mir-339a, bta-mir-374b, bta-mir-375, bta-mir-378-1, bta-mir-491, bta-mir-92a-1, bta-mir-92b, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, bta-mir-320b, bta-mir-339b, bta-mir-19b-2, bta-mir-320a-1, bta-mir-193a-2, bta-mir-378-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, bta-mir-148c, hsa-mir-374c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-378j, bta-mir-378b, bta-mir-378c, bta-mir-378d, bta-mir-374c, bta-mir-148d
Let-7a, let-7c, miR-181b, miR-185, miR-378 and miR-423-5p were predicted to target the inducible co-stimulatory molecule (ICOS), which plays a key role in regulating T-cell differentiation, T-cell proliferation, and secretion of lymphokines, providing effective help for antibody secretion by B cells [86]. [score:4]
The miR-181 (181a/b/c/d) family is related to the development of different cells. [score:2]
In the miR-181 family, miR-181a and miR-181b were dominant types with 13,345 reads and 3,333 reads, respectively. [score:1]
Among all miRNAs clusters, there were several pre-miRNAs with intervening sequences of less than 1 kb, including 10 known clusters (miR-99b/let-7e/125a, miR-24-2/27b/23b, miR-99a/let-7c, miR-29b/29a, miR-221/222, miR-98/let-7f, miR-181c/d, miR-363/92a/19b-2/106a, miR-363/92a/19b-2, miR-181b-1/181a-1 and miR-17/18a/19b-1/92a-1) and 4 novel miRNAs clusters (cluster 3, 9, 12, 22). [score:1]
The let-7 family had 9 members, miR-181 family had 4 members (miR-181a/b/c/d) and miR-30 family had 5 members (miR-30a/b/c/d/e). [score:1]
In our study, 8 miRNA families (let-7, mir-1, mir-17, mir-181, mir-148, mir-30, mir-92 and mir-99) were found with at least 3 members among all exosome miRNAs. [score:1]
[1 to 20 of 6 sentences]
97
[+] score: 9
Wang L Wang YX Chen LP Ji ML Upregulation of microRNA-181b inhibits CCL18 -induced breast cancer cell metastasis and invasion via the NF-κB signaling pathwayOncol Lett. [score:6]
It is reported that miR-181b inhibits CCL18 -induced breast cancer cell metastasis and invasion via the NF-κB signaling pathway [20]. [score:3]
[1 to 20 of 2 sentences]
98
[+] score: 9
The four exceptions were mir-16-1, mir-17, mir-181b-1, and mir-181b-2. As a putative miRNA oncogene, most of the new literature supports up-regulation of miR-17-5p in cancers but Cloonan et al. reported that it may act as a suppressor in some situations [47]. [score:6]
miR-181b was reported to show increased expression in early onset colorectal carcinoma [49]. [score:3]
[1 to 20 of 2 sentences]
99
[+] score: 9
In one of the cohorts, a high tumor to normal expression ratio of miR-20a, miR-21, miR-106a, miR-181b and miR-203 was associated with poor survival. [score:3]
However, the detailed molecular and cellular mechanisms of let-7g and miR-181b in mediating translational control will require further studies to elucidate the link of these miRNAs in chemosensitivity to fluoropyrimidine -based drugs in colon cancer. [score:3]
The roles of let-7g and miR-181b in chemosensitivity are associated with their regulation of several genes such as RAS, cyclin D, C-MYC, E2F and cytochrome C [93]. [score:2]
Let-7g and miR-181b were also shown to be associated with chemosensitivity to S-1 (a pro-drug of 5-FU) based chemotherapy in colon cancer. [score:1]
[1 to 20 of 4 sentences]
100
[+] score: 9
In addition, miRNA-181 expression was found to be elevated in response to acute endurance training in murine quadriceps femoris muscles, indicating a possible regulatory function in the adaptive processes to endurance exercise (Safdar et al., 2009) and also rises in circulating levels of miRNA-181b - but not of miRNA-181a - were detected with peaks directly after an uphill course, probably as an immediate consequence of hypoxia (Banzet et al., 2013). [score:5]
And in vascular endothelial cells miRNA-181b was noticed to block inflammatory signaling via NF-κB by regulating importin α3, a factor involved in the transport of NF-κB into the nucleus (Sun et al., 2012). [score:2]
MicroRNA-181b regulates NF-κB -mediated vascular inflammation. [score:1]
All of this suggests that members of the miRNA-181 family might be important for both contributing to an anti-inflammatory environment and inducing adaptations in response to exercise. [score:1]
[1 to 20 of 4 sentences]