sort by

4 publications mentioning bta-mir-211

Open access articles that are associated with the species Bos taurus and mention the gene name mir-211. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 50
MiRNA name Target gene in MAPK signaling pathway MiR-10b BDNF MiR-211 SOS1 MiR-143 CACNA1E, FGF1, MAPK7, MAP3K7, PDGFRA, KRAS MiR-30a RAP1B, RASA1, RAPGEF2, TAOK1, CACNB2, CASP3, CACNA1C, IL1A, MAP2K4, MAP3K1, MAP3K12, MAP3K2, MAP3K5, NF1, PPP3CA, PPP3CB, RPS6KA2, CRKL MiR-146a TRAF6 To gain an insight into the molecular functions of genes in biological processes, we annotated the genes targeted by differentially expressed miRNAs using GO categories (Table S5). [score:7]
MiRNA name Target gene in MAPK signaling pathway MiR-10b BDNF MiR-211 SOS1 MiR-143 CACNA1E, FGF1, MAPK7, MAP3K7, PDGFRA, KRAS MiR-30a RAP1B, RASA1, RAPGEF2, TAOK1, CACNB2, CASP3, CACNA1C, IL1A, MAP2K4, MAP3K1, MAP3K12, MAP3K2, MAP3K5, NF1, PPP3CA, PPP3CB, RPS6KA2, CRKL MiR-146a TRAF6 To gain an insight into the molecular functions of genes in biological processes, we annotated the genes targeted by differentially expressed miRNAs using GO categories (Table S5). [score:7]
Five differentially expressed miRNAs between the white and brown skin of alpaca were identified by quantitative PCR, including miR-211 and miR-202, which were significantly expressed in brown and white skins, respectively [17]. [score:5]
One study reported that miR-211 is highly expressed in brown alpaca skin via white alpaca skin expression [17]. [score:5]
The expressions of two miRNAs, miR-10b and miR-211, were confirmed (Figure 5). [score:3]
Figure 5The expression of miR-211 and miR-10b in two tissues. [score:3]
The expression levels of miR-10b and miR-211 were significantly higher in black follicles than in white follicles. [score:3]
Studies have shown that miR-211 is induced by the expression of MITF [47, 48]. [score:3]
Two differentially expressed miRNAs, miR-10b and miR-211, were verified by qPCR. [score:3]
This could explain why the expression of miR-211 is higher in black follicles than in white follicles. [score:3]
MiR-211 had a similar expression pattern to miR-10b. [score:3]
However, how miR-211 regulates melanocytes or melanin synthesis is not clear. [score:2]
MiRNA Primer sequences Goat-miR-211 Forward: TCGGCAGGTCCCTTTGTCATCC Reverse: TGCAGGTCAACTGGTGTCGT Loop prime: CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTGGGCAAA Goat-miR-10b Forward: TCGGCAGGACCCTGTAGAACCG Reverse: TGCAGGTCAACTGGTGTCGT Loop prime: CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCACAAATT U6 Forward: CTCGCTTCGGCAGCACA Reverse: AACGCTTCACGAATTTGCGT The TargetScan website (http://www. [score:2]
MiR-211 is highly expressed in black hair follicle (BF) compared with the white hair follicle (WF). [score:1]
[1 to 20 of 14 sentences]
2
[+] score: 19
For example, in mid-jejunum, miR-486, miR-146b and miR-7 had divergent regulation from D7 to D21; in ileum, miR-211 revealed significant down-regulation from D7 to D21 by qRT-PCR, but there was no significant difference identified by sequencing. [score:5]
Therefore, the detected temporal changes of miR-211 expression in mid-jejunum and ileum (Table S2) may be driven by the bacterial colonization and may be a key link between the gut microbiota and mucosal immune system development. [score:4]
For example, miR-211 has predicted targets involved in IL-6 and IL-17 cytokine signaling pathways as well as differentiation of T lymphocytes (Table 1). [score:3]
Most of temporal DE miRNAs showed the expression in agreement between miRNA-seq and qRT-PCR; however, three of them (miR-486, miR-146b, miR-7, and miR-211) revealed opposite trends between miRNA-seq and qRT-PCR in some comparison groups (Figure 8). [score:3]
Temporally DE miRNAs in small intestine (miR-146, miR-191, miR-33, miR-7, miR-99/100, miR-486, miR-145, and miR-211) were predicted to be related to gut epithelial cells development, immune cells development, inflammatory response, and other functions (Table 1). [score:3]
A total of 13 regional and temporal DE miRNAs (regional DE miRNAs: miR-192, miR-194, miR-205, miR-31, and miR-196; temporal DE miRNAs: miR-146b, miR-191, miR-99a, miR-145, miR-211, miR-486, miR-33, miR-7, and miR-196b) that identified from miRNA-seq were selected for validation using stem-loop qRT-PCR. [score:1]
[1 to 20 of 6 sentences]
3
[+] score: 5
Other miRNAs from this paper: ssc-mir-122, ssc-mir-125b-2, ssc-mir-181b-2, ssc-mir-20a, ssc-mir-23a, ssc-mir-26a, ssc-mir-29b-1, ssc-mir-181c, ssc-mir-214, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-107, ssc-mir-21, ssc-mir-29c, ssc-mir-30c-2, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-103-1, bta-mir-20a, bta-mir-21, bta-mir-26b, bta-mir-30d, bta-mir-499, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-mir-199a-1, bta-mir-30b, bta-mir-107, bta-mir-10a, bta-mir-127, bta-mir-142, bta-mir-181b-2, bta-mir-30e, bta-mir-92a-2, bta-let-7d, bta-mir-132, bta-mir-138-2, bta-mir-17, bta-mir-181c, bta-mir-192, bta-mir-199b, bta-mir-200a, bta-mir-200c, bta-mir-214, bta-mir-23a, bta-mir-29b-2, bta-mir-29c, bta-mir-455, bta-let-7g, bta-mir-10b, bta-mir-30a, bta-mir-200b, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-mir-30c, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-99b, ssc-mir-99b, ssc-mir-17, ssc-mir-30b, ssc-mir-199b, bta-mir-1-2, bta-mir-1-1, bta-mir-129-1, bta-mir-129-2, bta-mir-133a-2, bta-mir-133a-1, bta-mir-133b, bta-mir-135b, bta-mir-138-1, bta-mir-143, bta-mir-144, bta-mir-146b, bta-mir-146a, bta-mir-181d, bta-mir-190a, bta-mir-199a-2, bta-mir-202, bta-mir-206, bta-mir-212, bta-mir-223, bta-mir-26a-1, bta-mir-29d, bta-mir-30f, bta-mir-338, bta-mir-33a, bta-mir-33b, bta-mir-375, bta-mir-429, bta-mir-451, bta-mir-92a-1, bta-mir-92b, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, ssc-mir-133a-1, ssc-mir-1, ssc-mir-146b, ssc-mir-181a-1, ssc-mir-30a, bta-mir-199c, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-133b, ssc-mir-29a, ssc-mir-30d, ssc-mir-30e, ssc-mir-199a-2, ssc-mir-499, ssc-mir-143, ssc-mir-10a, ssc-mir-10b, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-99a, ssc-mir-92a-2, ssc-mir-92a-1, ssc-mir-92b, ssc-mir-192, ssc-mir-142, ssc-mir-127, ssc-mir-202, ssc-mir-129a, ssc-mir-455, ssc-mir-125b-1, ssc-mir-338, ssc-mir-133a-2, ssc-mir-146a, bta-mir-26c, ssc-mir-30c-1, ssc-mir-126, ssc-mir-199a-1, ssc-mir-451, ssc-let-7a-2, ssc-mir-129b, ssc-mir-429, ssc-let-7d, ssc-let-7f-2, ssc-mir-29b-2, ssc-mir-132, ssc-mir-138, ssc-mir-144, ssc-mir-190a, ssc-mir-212, bta-mir-133c, ssc-mir-26b, ssc-mir-200b, ssc-mir-223, ssc-mir-375, ssc-mir-33b
Some muscle miRNAs have well-defined target genes, as miR-206 regulates IGF-1; miR-1, miR-122, and miR-462 control IGF-2a; the let-7 family regulates MSTN; miR-103 and miR-107 modulate GHR and FSHR; and miR-138 and miR-211 control LHR. [score:5]
[1 to 20 of 1 sentences]
4
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-32, hsa-mir-33a, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-99a, mmu-mir-126a, mmu-mir-128-1, mmu-mir-130a, mmu-mir-140, mmu-mir-154, mmu-mir-204, mmu-mir-143, hsa-mir-204, hsa-mir-211, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-222, hsa-mir-223, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-128-1, hsa-mir-130a, hsa-mir-140, hsa-mir-143, hsa-mir-126, hsa-mir-129-2, hsa-mir-154, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-129-2, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-340, mmu-mir-107, mmu-mir-32, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-223, mmu-mir-26a-2, mmu-mir-211, mmu-mir-222, mmu-mir-128-2, hsa-mir-128-2, hsa-mir-29c, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-26a-2, hsa-mir-379, mmu-mir-379, hsa-mir-340, mmu-mir-409, hsa-mir-409, hsa-mir-499a, hsa-mir-455, hsa-mir-670, mmu-mir-1249, mmu-mir-670, mmu-mir-499, mmu-mir-455, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-101-2, bta-mir-103-1, bta-mir-16b, bta-mir-222, bta-mir-26b, bta-mir-27a, bta-mir-499, bta-mir-99a, bta-mir-126, bta-mir-128-1, bta-mir-34b, bta-mir-107, bta-mir-140, bta-mir-15b, bta-mir-218-2, bta-let-7d, bta-mir-29c, bta-mir-455, bta-let-7g, bta-let-7a-1, bta-let-7f-1, bta-let-7i, bta-mir-34c, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-204, hsa-mir-1249, hsa-mir-1306, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-128-2, bta-mir-129-2, bta-mir-130a, bta-mir-143, bta-mir-154a, bta-mir-218-1, bta-mir-223, bta-mir-26a-1, bta-mir-301a, bta-mir-32, bta-mir-33a, bta-mir-340, bta-mir-379, bta-mir-409a, bta-mir-670, mmu-mir-1306, bta-mir-1306, bta-mir-1249, bta-mir-2284i, bta-mir-2285a, bta-mir-2284s, bta-mir-2285d, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2285b-1, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2285c, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-2284e, hsa-mir-1260b, bta-mir-2284w, bta-mir-2284x, bta-mir-409b, hsa-mir-499b, bta-mir-1260b, bta-mir-2284y-1, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-6119, mmu-let-7j, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2284y-2, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2284y-3, bta-mir-154c, bta-mir-154b, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2284y-7, bta-mir-2285n-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2285k-2, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2284z-4, bta-mir-2285k-5, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2284z-2, mmu-let-7k, mmu-mir-126b, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2284ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2284ac, bta-mir-2285ae, chi-let-7a, chi-let-7b, chi-let-7c, chi-let-7d, chi-let-7e, chi-let-7f, chi-let-7g, chi-let-7i, chi-mir-103, chi-mir-107, chi-mir-1249, chi-mir-126, chi-mir-1306, chi-mir-130a, chi-mir-140, chi-mir-143, chi-mir-154a, chi-mir-154b, chi-mir-15b, chi-mir-16b, chi-mir-204, chi-mir-211, chi-mir-222, chi-mir-223, chi-mir-2284a, chi-mir-2284b, chi-mir-2284c, chi-mir-2284d, chi-mir-2284e, chi-mir-26a, chi-mir-26b, chi-mir-27a, chi-mir-29a, chi-mir-29c, chi-mir-301a, chi-mir-33a, chi-mir-340, chi-mir-34b, chi-mir-34c, chi-mir-379, chi-mir-409, chi-mir-455, chi-mir-499, chi-mir-99a, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
Among these, 16 precursors were found amongst the 43 conserved between human, mouse, cow and goat in our analysis (let-7 g, mir-101-2, mir-103, mir-107, mir-128-1, mir-1306, mir-140, mir-15b, mir-16b, mir-211, mir-218-1, mir-26a-1, mir-32, mir-33a, mir-455, let-7-2), so the location of these precursors appears to be highly conserved in all vertebrates. [score:1]
[1 to 20 of 1 sentences]