sort by

2 publications mentioning bta-mir-1343

Open access articles that are associated with the species Bos taurus and mention the gene name mir-1343. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 6
Other miRNAs from this paper: ssc-mir-122, ssc-mir-135-1, ssc-mir-135-2, ssc-mir-148a, ssc-mir-19a, ssc-mir-20a, ssc-mir-224, ssc-mir-24-1, ssc-mir-323, ssc-mir-140, ssc-mir-183, ssc-mir-214, ssc-mir-27a, ssc-mir-325, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-107, ssc-mir-136, ssc-mir-153, ssc-mir-18a, ssc-mir-186, ssc-mir-196a-2, ssc-mir-204, ssc-mir-21, bta-mir-18b, bta-let-7f-2, bta-mir-101-2, bta-mir-103-1, bta-mir-148a, bta-mir-18a, bta-mir-20a, bta-mir-21, bta-mir-221, bta-mir-27a, bta-mir-27b, bta-mir-107, bta-mir-140, bta-mir-20b, bta-mir-215, bta-let-7d, bta-mir-17, bta-mir-186, bta-mir-199b, bta-mir-210, bta-mir-214, bta-mir-450a-2, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-15a, bta-mir-19a, bta-mir-204, ssc-mir-15a, ssc-mir-17, ssc-mir-199b, ssc-mir-210, ssc-mir-221, bta-mir-101-1, bta-mir-133a-2, bta-mir-133a-1, bta-mir-135a-2, bta-mir-135a-1, bta-mir-135b, bta-mir-136, bta-mir-146b, bta-mir-153-1, bta-mir-153-2, bta-mir-183, bta-mir-24-1, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-224, bta-mir-323, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-450a, ssc-mir-146b, ssc-mir-215, bta-mir-2320, bta-mir-2326, bta-mir-2366, bta-mir-2411, bta-mir-2483, bta-mir-450a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-103-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-196b-1, ssc-mir-450b, ssc-mir-450c, ssc-mir-133a-2, ssc-let-7a-2, ssc-mir-18b, ssc-mir-1343, ssc-mir-2320, bta-mir-450b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-196a-1, ssc-mir-196b-2, ssc-mir-2366-1, ssc-mir-2366-2, ssc-mir-2411, ssc-mir-2483
The expressions of miR-1343, miR-2320 and miR-2411 were slightly higher in Meishan samples; miR-2483 higher in large White samples (Table S2). [score:3]
A. miR-1343, miR-2320, miR-2411 and miR-2483 were cloned in porcine backfat tissue of Large White and Meishan samples. [score:1]
miR-1343, miR-2320, miR-2411 and miR-2483 were cloned in porcine backfat tissue of Large White and Meishan samples. [score:1]
miRNA-name precusor-miRNA Minimum free energy(kcal/mol) bta-mir-1343 GGCTTCGGTGCTGGGGAGCGGCCCCCGGGCGGGCCTCTGCTCTGGCCC CTCCTGGGGCCCGCACTCTCGCTCCGGGCC ssc-mir-1343 GGCTTCGGTGCTGGGGAGCGGCCCCCGGGCGGGCCTCTGCTCTGGCCC CTCCTGGGGCCCGCACTCTCGCTCCGGGTC −50.3 bta-mir-2320 TGTCCCCA TGGCACAGGGTCCAGCTGTCGGCCGTGATACCCGATGGGTCGATGATGGTCCCTGTGTTTTGGGGCG ssc-mir-2320 TGTCCCCA TGGCACAGGGTCCAGCTGTCGGCTGTAATACCCGATGGGTCGATGATGGTCCCTGTGTTTGGGGCG −37.7 bta-mir-2366 CCCCGGGGTCCTCTTGTCTGAGCCCCAGAAAGAGGAGAGAGTGC TGGGTCACAGAAGAGGGTCTGGGGG ssc-mir-2366 CCCCAGGGTCCTCTTGTCTGAGCCCCAGAAAGAGGAGAGAGCGC TGGGTCACAGAAGAGGGTCTGGGGG −31.6 bta-mir-2411 GAGGAAATG TGGAGTGACTGTCAGATGCAGCCAGCAGAATAAGTGGTTTGGCTGAACTGTCTTACTCCCACATCCTC ssc-mir-2411 GAGGCAATGT GGAGTGACTGTCAGATGCAGCCATCAGAATAGGTGATTTGGCTGAACTGTCATACTCCCACATCCTC −29.2 bta-mir-2483 GAGTGAAAAGTTCCGTCAACCATCCAGCTGTTTGAGGTGATGC AAACAAACATCTGGTTGGTTGAGAGAATTTTTTACTT ssc-mir-2483 GAGTGAAAAGTTCCGTCAACCATCCAGCTGTTTGGGGTGATGC AAACAAACATCTGGTTGGTTGAGAGAATTTTTTACTT −37.3 Note: The bold are the mature miRNA sequences. [score:1]
[1 to 20 of 4 sentences]
2
[+] score: 1
Chen et al. [77] recently demonstrated that the addition of porcine milk exosomes to IPEC-J2 intestinal cells raised intracellular levels of milk-specific miRNA-7134, miRNA-1343, miRNA-2320, miRNA-181a, miRNA-769-3p, and miRNA-128. [score:1]
[1 to 20 of 1 sentences]