sort by

1 publications mentioning bdi-MIR9486a

Open access articles that are associated with the species Brachypodium distachyon and mention the gene name MIR9486a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 1
2UGGAGAUUGACUUAGAAGCGG213607731Bdi-miR7731AACAAGGGAUGCACAUACUUUGAG248367738Bdi-miR7738-3pGUGCUUGACAGACGACUCUGG214467754Bdi-miR7754-3pUUCUCUCGGCUAAGGAACUGC213929480Bdi-miR9480abUAUGUGAGGGUGGUAACUGAA211,6459481Bdi-miR9481aUCAGUCGGAUUUCUCACCUUCGAA24384Bdi-miR9481bUCAGUCGGAUUUCUCACCUUC21739482Bdi-miR9482CCUUUGGGGAAGAAGGGAAAC213399483Bdi-miR9483abUUGAACUGUUUCCUCUGAAGUUCC243179484Bdi-miR9484UAGUGCAGGGAGAAGUCGGUC212599485Bdi-miR9485UUAUGACGUGUAGGAGUUGCA212609486Bdi-miR9486aAUGCUUUCAAGGGAUUAGAGGUUC24254Bdi-miR9486a. [score:1]
[1 to 20 of 1 sentences]