Accession | MIMAT0000449 |
Description | hsa-miR-146a-5p mature miRNA |
Hairpins | |
Sequence | UGAGAACUGAAUUCCAUGGGUU |
Evidence |
experimental
cloned [2-3] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of | GO:0010887 negative regulation of cholesterol storage |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21329689 | occurs_in CL:0000517 |
acts_upstream_of | GO:0032715 negative regulation of interleukin-6 production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21329689 | occurs_in CL:0000517 |
acts_upstream_of | GO:0032715 negative regulation of interleukin-6 production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29896267 | occurs_in CL:0000583 |
acts_upstream_of | GO:0032717 negative regulation of interleukin-8 production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21329689 | occurs_in CL:0000517 |
acts_upstream_of | GO:0035305 negative regulation of dephosphorylation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27221467 | has_input UniProtKB:P10636 |
acts_upstream_of | GO:0043065 positive regulation of apoptotic process |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:27241555 | occurs_in CL:0000540 |
acts_upstream_of | GO:0050728 negative regulation of inflammatory response |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:21329689 | occurs_in CL:0000517 |
acts_upstream_of | GO:0051898 negative regulation of phosphatidylinositol 3-kinase/protein kinase B signal transduction |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:27241555 | occurs_in CL:0000540 |
acts_upstream_of | GO:0060392 negative regulation of SMAD protein signal transduction |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:30779466 | occurs_in CL:0002539 |
acts_upstream_of | GO:1902532 negative regulation of intracellular signal transduction |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21329689 | occurs_in CL:0000517 |
acts_upstream_of | GO:1904465 negative regulation of matrix metallopeptidase secretion |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21329689 | occurs_in CL:0000517 |
acts_upstream_of | GO:1904707 positive regulation of vascular associated smooth muscle cell proliferation |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:30779466 | occurs_in CL:0002539 |
acts_upstream_of | GO:1904754 positive regulation of vascular associated smooth muscle cell migration |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:30779466 | occurs_in CL:0002539 |
acts_upstream_of | GO:1904995 negative regulation of leukocyte adhesion to vascular endothelial cell |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25515214 | occurs_in CL:2000044 |
acts_upstream_of | GO:1905709 negative regulation of membrane permeability |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31926946 | occurs_in CL:0002618 |
acts_upstream_of | GO:2000342 negative regulation of chemokine (C-X-C motif) ligand 2 production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21329689 | occurs_in CL:0000517 |
acts_upstream_of | GO:2000438 negative regulation of monocyte extravasation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31926946 | |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21329689 | has_input UniProtKB:O00206 |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27221467 | |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30779466 | has_input UniProtKB:Q13485 |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31926946 | |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:16885212 | has_input UniProtKB:P51617 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:19333922 | has_input UniProtKB:P42224 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:19333922 | has_input UniProtKB:Q13568 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:20181935 | has_input UniProtKB:P80075 |
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
---|
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
Disease | Differential expression | Experiment | Year | Study |
---|