Home
(current)
Search
Browse
Help
Downloads
Home
(current)
Search
Browse
Help
Downloads
miRBase entry: cel-miR-77-3p
Mature
cel-miR-77-3p
Accession
MIMAT0000049
Description
cel-miR-77-3p mature miRNA
Hairpins
cel-mir-77
Sequence
UUCAUCAGGCCAUAGCUGUCCA
Copy Sequence
Evidence
experimental
cloned [1-2], 454 [3], Illumina [4,6], CLIPseq [5]
Database links
Predicted targets