Mature hsa-miR-98-5p
| Accession | MIMAT0000096 |
| Description | hsa-miR-98-5p mature miRNA |
| Hairpins | |
| Sequence | UGAGGUAGUAAGUUGUAUUGUU |
| Evidence |
experimental
cloned [1-3], SOLiD [4] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| acts_upstream_of | GO:0008285 negative regulation of cell population proliferation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31886314 | occurs_in CL:2000001 |
| acts_upstream_of | GO:0010629 negative regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:27860183 | has_input UniProtKB:Q13950 |
| acts_upstream_of | GO:0010629 negative regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31886314 | has_input UniProtKB:P01375 |
| acts_upstream_of | GO:0010629 negative regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31886314 | has_input UniProtKB:P01584 |
| acts_upstream_of | GO:0010629 negative regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31886314 | has_input UniProtKB:P10145 |
| acts_upstream_of | GO:0030514 negative regulation of BMP signaling pathway |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:27860183 | has_input UniProtKB:P12643 |
| acts_upstream_of | GO:0032691 negative regulation of interleukin-1 beta production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31886314 | occurs_in CL:2000001 |
| acts_upstream_of | GO:0032693 negative regulation of interleukin-10 production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29702181 | occurs_in CL:0000863 |
| acts_upstream_of | GO:0032693 negative regulation of interleukin-10 production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31886314 | occurs_in CL:2000001 |
| acts_upstream_of | GO:0032717 negative regulation of interleukin-8 production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31886314 | occurs_in CL:2000001 |
| acts_upstream_of | GO:0032720 negative regulation of tumor necrosis factor production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31886314 | occurs_in CL:2000001 |
| acts_upstream_of | GO:1901202 negative regulation of extracellular matrix assembly |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:28251559 | occurs_in CL:0002548 |
| acts_upstream_of_or_within | GO:0045668 negative regulation of osteoblast differentiation |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:27860183 | occurs_in CL:0002540 |
| enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22492871 | has_input UniProtKB:O00264 |
| enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22492871 | |
| enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27860183 | has_input UniProtKB:P12643 |
| enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31886314 | has_input UniProtKB:P05231 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22492871 | has_input UniProtKB:O00264 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22492871 | has_input UniProtKB:P11511 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26098770 | has_input UniProtKB:P05305 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26587789 | has_input UniProtKB:P05231 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27541017 | has_input UniProtKB:Q9UNH7 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27860183 | has_input UniProtKB:P12643 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:28251559 | occurs_in CL:0002548 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29702181 | has_input UniProtKB:P22301 |
StarBase
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
| Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
|---|
miR2Disease
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
| Disease | Differential expression | Experiment | Year | Study |
|---|
