miRBase entry: hsa-mir-98

Stem-loop hsa-mir-98


Accession
MI0000100
Symbol
HGNC: MIR98
Description
Homo sapiens hsa-mir-98 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR98 is a microRNA implicated in the regulation of breast cancer metastasis, as evidenced by in vivo experiments where MDA-MB-231 breast cancer cells, infected with a lentivirus carrying MIR98, were inoculated into the mammary fat pads of nude mice and stimulated with CCL18 [PMC4653020]. This microRNA was among seven selected for validation of array-based expression data using Taqman quantitative RT-PCR, highlighting its significance in the study [PMC3288043]. Furthermore, MIR98 is involved in a regulatory pathway where its expression is increased upon the silencing of N-Ras, leading to the inactivation of the ERK/PI3K/NFκB/Lin28b pathway and loss of its inhibitor Lin28b; this upregulation of MIR98 contributes to further inhibition of N-Ras expression [PMC4653020].

Literature search
137 open access papers mention hsa-mir-98
(565 sentences)

Sequence

58286 reads, 316 reads per million, 131 experiments
aggauucugcucaugccagggUGAGGUAGUAAGUUGUAUUGUUgugggguagggauauuaggccccaauuagaagauaaCUAUACAACUUACUACUUUCCCugguguguggcauauuca
.((((..((((((((((((((.(((((((((((((((((.((((((((((...........)))))).........)))).))))))))))))))))))))))))))).)))).)))).

Structure
a    uc    -          U                 U    ---------      aggg 
 ggau  ugcu caugccaggg GAGGUAGUAAGUUGUAU GUUg         uggggu    a
 ||||  |||| |||||||||| ||||||||||||||||| ||||         ||||||    u
 cuua  acgg gugugguCCC UUUCAUCAUUCAACAUA Caau         accccg    a
a    -u    u          -                 U    agaagauua      gauu 


Annotation confidence High
Do you think this miRNA is real?
Comments
This sequence is localised to chromosome X and was named mir-98-X in reference [1]. The predicted stem-loop precursor sequence is clearly related to let-7.

Genome context
chrX: 53556223-53556341 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-98
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-98 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID

Biological pathways
hsa-mir-98 is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-mir-98 is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-miR-98-5p

Accession MIMAT0000096
Description Homo sapiens hsa-miR-98-5p mature miRNA
Sequence 22 - UGAGGUAGUAAGUUGUAUUGUU - 43
Evidence experimental
cloned [1-3], SOLiD [4]
Database links
Predicted targets

Mature hsa-miR-98-3p

Accession MIMAT0022842
Description Homo sapiens hsa-miR-98-3p mature miRNA
Sequence 80 - CUAUACAACUUACUACUUUCCC - 101
Evidence experimental
SOLiD [4]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 11914277
    miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs
    "Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G"
    "Genes Dev (2002) 16:720-728

  4. PubMed ID: 22282338
    Deep-sequencing of endothelial cells exposed to hypoxia reveals the complexity of known and novel microRNAs
    "Voellenkle C, Rooij Jv, Guffanti A, Brini E, Fasanaro P, Isaia E, Croft L, David M, Capogrossi MC, Moles A, Felsani A, Martelli F"
    "RNA (2012) 18:472-484