Accession | MIMAT0000140 |
Description | mmu-miR-128-3p mature miRNA |
Hairpins | |
Sequence | UCACAGUGAACCGGUCUCUUU |
Evidence |
experimental
cloned [3], Illumina [4-5] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24835278 | has_input UniProtKB:Q64729 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30412727 | has_input UniProtKB:P37238 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:33058756 | has_input UniProtKB:P37238 |
involved_in | GO:0010985 negative regulation of lipoprotein particle clearance |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26501192 | |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24835278 | has_input UniProtKB:Q64729 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30412727 | has_input UniProtKB:P37238 |
involved_in | GO:0035279 miRNA-mediated gene silencing by mRNA destabilization |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:33058756 | has_input UniProtKB:P37238 |
involved_in | GO:0042632 cholesterol homeostasis |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26501192 | |
involved_in | GO:0055088 lipid homeostasis |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26501192 | |
involved_in | GO:0090370 negative regulation of cholesterol efflux |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26501192 | occurs_in CL:0000235 |
involved_in | GO:0150078 positive regulation of neuroinflammatory response |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:30412727 | |
involved_in | GO:1903444 negative regulation of brown fat cell differentiation |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:33058756 | |
involved_in | GO:1903980 positive regulation of microglial cell activation |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:30412727 |