Accession | MIMAT0000263 |
Description | hsa-miR-199b-5p mature miRNA |
Hairpins | |
Sequence | CCCAGUGUUUAGACUAUCUGUUC |
Evidence |
experimental
cloned [2-3] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
NOT|involved_in | GO:0045765 regulation of angiogenesis |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | |
NOT|involved_in | GO:1905203 regulation of connective tissue replacement |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:15131085 | has_input UniProtKB:Q13753 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:32082362 | occurs_in CL:0002543 |
involved_in | GO:0016525 negative regulation of angiogenesis |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:32082362 | occurs_in CL:0002543 |
involved_in | GO:0030514 negative regulation of BMP signaling pathway |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:32082362 | occurs_in CL:0002543 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:15131085 | has_input UniProtKB:Q13753 |
involved_in | GO:0035279 miRNA-mediated gene silencing by mRNA destabilization |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:32082362 | occurs_in CL:0002543 |
involved_in | GO:0045603 positive regulation of endothelial cell differentiation |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | |
involved_in | GO:0045766 positive regulation of angiogenesis |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | |
involved_in | GO:0050714 positive regulation of protein secretion |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | regulates_transport_of UniProtKB:P78504 |
involved_in | GO:0051151 negative regulation of smooth muscle cell differentiation |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | |
involved_in | GO:0060044 negative regulation of cardiac muscle cell proliferation |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | |
involved_in | GO:0061052 negative regulation of cell growth involved in cardiac muscle cell development |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | |
involved_in | GO:1900239 regulation of phenotypic switching |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | |
located_in | GO:0005615 extracellular space |
ECO:0007005 high throughput direct assay evidence used in manual assertion |
PMID:26646931 | part_of UBERON:0001969 |
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
---|
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
Disease | Differential expression | Experiment | Year | Study |
---|