MIR199B is a type of microRNA that has been studied in various contexts. Over-expression of MIR199B did not significantly affect the levels of HIF-1α mRNA and NFκB mRNA and protein [PMC3645752]. The PCR primers for mature MIR199B were designed and the product length was determined to be 66 bp [PMC3645752]. The deficiency of MIR199B led to the elimination of the protective function of mmu-miR-199b-3p, resulting in increased levels of ACR, BUN, Cr, and proteinuria [PMC8257373]. Interestingly, higher levels of MIR199B were found in the plasma of patients infected with SARS-CoV2 virus [PMC9677482]. In breast cancer, MIR199B was found to be up-regulated along with miR26b, while miR126, miR146a, miR34a were down-regulated [PMC3828615]. The potential role of MIR199B in VEGF transcriptional activation and secretion has been investigated through additional experiments [PMC4737258]. In cancer stem cells and medulloblastoma growth inhibition experiments, inhibition of transcription factor HES1 by MIR199B repressed pluripotency [PMC3645752]. Overexpression of certain microRNAs including MIR199B was associated with shorter survival PFS in certain patients while increased expression of other microRNAs was observed only in patients with intermediate and high cytogenetic risk [PMC6183594].
a -acacc - c C U U U gacu cc gagg ucca cuc gucua CCAGUGU UAGACUA CUGU Cag c || |||| |||| ||| ||||| ||||||| ||||||| |||| ||| gg cucc gggu ggg cggAU GGUUACA GUCUGAU GACA guu c - cagauu c u U C - u aaac
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000263 |
Description | Homo sapiens hsa-miR-199b-5p mature miRNA |
Sequence | 26 - CCCAGUGUUUAGACUAUCUGUUC - 48 |
Evidence |
experimental
cloned [2-3] |
Database links | |
Predicted targets |
Accession | MIMAT0004563 |
Description | Homo sapiens hsa-miR-199b-3p mature miRNA |
Sequence | 65 - ACAGUAGUCUGCACAUUGGUUA - 86 |
Evidence |
experimental
cloned [3] |
Database links | |
Predicted targets |
|